ID: 1164493708

View in Genome Browser
Species Human (GRCh38)
Location 19:28737960-28737982
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164493708_1164493712 -6 Left 1164493708 19:28737960-28737982 CCAAGAGTTAAACGATGACCACA No data
Right 1164493712 19:28737977-28737999 ACCACAACTCACACAGGGATGGG No data
1164493708_1164493715 23 Left 1164493708 19:28737960-28737982 CCAAGAGTTAAACGATGACCACA No data
Right 1164493715 19:28738006-28738028 GGAGTTCAGACAAGCCAGAGCGG No data
1164493708_1164493714 2 Left 1164493708 19:28737960-28737982 CCAAGAGTTAAACGATGACCACA No data
Right 1164493714 19:28737985-28738007 TCACACAGGGATGGGAGACATGG No data
1164493708_1164493711 -7 Left 1164493708 19:28737960-28737982 CCAAGAGTTAAACGATGACCACA No data
Right 1164493711 19:28737976-28737998 GACCACAACTCACACAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164493708 Original CRISPR TGTGGTCATCGTTTAACTCT TGG (reversed) Intergenic