ID: 1164493709

View in Genome Browser
Species Human (GRCh38)
Location 19:28737971-28737993
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164493705_1164493709 23 Left 1164493705 19:28737925-28737947 CCACATGTTACTAGGGTGAAACT No data
Right 1164493709 19:28737971-28737993 ACGATGACCACAACTCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164493709 Original CRISPR ACGATGACCACAACTCACAC AGG Intergenic