ID: 1164493711 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:28737976-28737998 |
| Sequence | GACCACAACTCACACAGGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164493708_1164493711 | -7 | Left | 1164493708 | 19:28737960-28737982 | CCAAGAGTTAAACGATGACCACA | No data | ||
| Right | 1164493711 | 19:28737976-28737998 | GACCACAACTCACACAGGGATGG | No data | ||||
| 1164493705_1164493711 | 28 | Left | 1164493705 | 19:28737925-28737947 | CCACATGTTACTAGGGTGAAACT | No data | ||
| Right | 1164493711 | 19:28737976-28737998 | GACCACAACTCACACAGGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164493711 | Original CRISPR | GACCACAACTCACACAGGGA TGG | Intergenic | ||