ID: 1164493712

View in Genome Browser
Species Human (GRCh38)
Location 19:28737977-28737999
Sequence ACCACAACTCACACAGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164493705_1164493712 29 Left 1164493705 19:28737925-28737947 CCACATGTTACTAGGGTGAAACT No data
Right 1164493712 19:28737977-28737999 ACCACAACTCACACAGGGATGGG No data
1164493708_1164493712 -6 Left 1164493708 19:28737960-28737982 CCAAGAGTTAAACGATGACCACA No data
Right 1164493712 19:28737977-28737999 ACCACAACTCACACAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164493712 Original CRISPR ACCACAACTCACACAGGGAT GGG Intergenic