ID: 1164493714

View in Genome Browser
Species Human (GRCh38)
Location 19:28737985-28738007
Sequence TCACACAGGGATGGGAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164493708_1164493714 2 Left 1164493708 19:28737960-28737982 CCAAGAGTTAAACGATGACCACA No data
Right 1164493714 19:28737985-28738007 TCACACAGGGATGGGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164493714 Original CRISPR TCACACAGGGATGGGAGACA TGG Intergenic