ID: 1164493715

View in Genome Browser
Species Human (GRCh38)
Location 19:28738006-28738028
Sequence GGAGTTCAGACAAGCCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164493708_1164493715 23 Left 1164493708 19:28737960-28737982 CCAAGAGTTAAACGATGACCACA No data
Right 1164493715 19:28738006-28738028 GGAGTTCAGACAAGCCAGAGCGG No data
1164493713_1164493715 5 Left 1164493713 19:28737978-28738000 CCACAACTCACACAGGGATGGGA No data
Right 1164493715 19:28738006-28738028 GGAGTTCAGACAAGCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164493715 Original CRISPR GGAGTTCAGACAAGCCAGAG CGG Intergenic