ID: 1164495144

View in Genome Browser
Species Human (GRCh38)
Location 19:28753936-28753958
Sequence CCGTGTCAGGTCATCCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164495144_1164495148 -2 Left 1164495144 19:28753936-28753958 CCAAGAGGGATGACCTGACACGG No data
Right 1164495148 19:28753957-28753979 GGTGAAGAGGAACTTCTCCCTGG No data
1164495144_1164495149 -1 Left 1164495144 19:28753936-28753958 CCAAGAGGGATGACCTGACACGG No data
Right 1164495149 19:28753958-28753980 GTGAAGAGGAACTTCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164495144 Original CRISPR CCGTGTCAGGTCATCCCTCT TGG (reversed) Intergenic
No off target data available for this crispr