ID: 1164501003

View in Genome Browser
Species Human (GRCh38)
Location 19:28820321-28820343
Sequence CCTCACAGGGAGGCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164500993_1164501003 21 Left 1164500993 19:28820277-28820299 CCCCTCCTTTGAGTGTGATGGTG No data
Right 1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG No data
1164500997_1164501003 -5 Left 1164500997 19:28820303-28820325 CCTTGCGTCAGTGACAGTCCTCA No data
Right 1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG No data
1164500996_1164501003 16 Left 1164500996 19:28820282-28820304 CCTTTGAGTGTGATGGTGACACC No data
Right 1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG No data
1164500994_1164501003 20 Left 1164500994 19:28820278-28820300 CCCTCCTTTGAGTGTGATGGTGA No data
Right 1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG No data
1164500991_1164501003 30 Left 1164500991 19:28820268-28820290 CCAGTGACTCCCCTCCTTTGAGT No data
Right 1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG No data
1164500995_1164501003 19 Left 1164500995 19:28820279-28820301 CCTCCTTTGAGTGTGATGGTGAC No data
Right 1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164501003 Original CRISPR CCTCACAGGGAGGCTGAGGC TGG Intergenic
No off target data available for this crispr