ID: 1164503655

View in Genome Browser
Species Human (GRCh38)
Location 19:28840329-28840351
Sequence ACCCTGGTTCTGTGATTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164503652_1164503655 14 Left 1164503652 19:28840292-28840314 CCAAGGAACAGGATGGGAAATGT No data
Right 1164503655 19:28840329-28840351 ACCCTGGTTCTGTGATTTACTGG No data
1164503649_1164503655 22 Left 1164503649 19:28840284-28840306 CCGAGACGCCAAGGAACAGGATG No data
Right 1164503655 19:28840329-28840351 ACCCTGGTTCTGTGATTTACTGG No data
1164503648_1164503655 23 Left 1164503648 19:28840283-28840305 CCCGAGACGCCAAGGAACAGGAT No data
Right 1164503655 19:28840329-28840351 ACCCTGGTTCTGTGATTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164503655 Original CRISPR ACCCTGGTTCTGTGATTTAC TGG Intergenic
No off target data available for this crispr