ID: 1164505454

View in Genome Browser
Species Human (GRCh38)
Location 19:28856989-28857011
Sequence TATTATCTTTATAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164505454_1164505461 30 Left 1164505454 19:28856989-28857011 CCGTCCACCTTATAAAGATAATA No data
Right 1164505461 19:28857042-28857064 ATAGTACTTAACACCATGGCTGG No data
1164505454_1164505457 -3 Left 1164505454 19:28856989-28857011 CCGTCCACCTTATAAAGATAATA No data
Right 1164505457 19:28857009-28857031 ATATCAGTGCCAATCTTACCAGG No data
1164505454_1164505460 26 Left 1164505454 19:28856989-28857011 CCGTCCACCTTATAAAGATAATA No data
Right 1164505460 19:28857038-28857060 ACATATAGTACTTAACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164505454 Original CRISPR TATTATCTTTATAAGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr