ID: 1164507277

View in Genome Browser
Species Human (GRCh38)
Location 19:28870417-28870439
Sequence GCTCCCCTCACAGAGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164507277_1164507290 13 Left 1164507277 19:28870417-28870439 CCGCCCTCCTCTGTGAGGGGAGC No data
Right 1164507290 19:28870453-28870475 CCTTTTCTGTGAAGGGAACTTGG No data
1164507277_1164507291 14 Left 1164507277 19:28870417-28870439 CCGCCCTCCTCTGTGAGGGGAGC No data
Right 1164507291 19:28870454-28870476 CTTTTCTGTGAAGGGAACTTGGG No data
1164507277_1164507285 6 Left 1164507277 19:28870417-28870439 CCGCCCTCCTCTGTGAGGGGAGC No data
Right 1164507285 19:28870446-28870468 GACCCGCCCTTTTCTGTGAAGGG No data
1164507277_1164507284 5 Left 1164507277 19:28870417-28870439 CCGCCCTCCTCTGTGAGGGGAGC No data
Right 1164507284 19:28870445-28870467 TGACCCGCCCTTTTCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164507277 Original CRISPR GCTCCCCTCACAGAGGAGGG CGG (reversed) Intergenic
No off target data available for this crispr