ID: 1164510963

View in Genome Browser
Species Human (GRCh38)
Location 19:28896939-28896961
Sequence CTCAGCTGGGAAGCATTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164510963_1164510970 20 Left 1164510963 19:28896939-28896961 CCAACAAATGCTTCCCAGCTGAG No data
Right 1164510970 19:28896982-28897004 TGATCACAAAATTGCCCAGTTGG No data
1164510963_1164510967 -4 Left 1164510963 19:28896939-28896961 CCAACAAATGCTTCCCAGCTGAG No data
Right 1164510967 19:28896958-28896980 TGAGAGGCAGTCACAGTGCCAGG No data
1164510963_1164510968 -3 Left 1164510963 19:28896939-28896961 CCAACAAATGCTTCCCAGCTGAG No data
Right 1164510968 19:28896959-28896981 GAGAGGCAGTCACAGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164510963 Original CRISPR CTCAGCTGGGAAGCATTTGT TGG (reversed) Intergenic
No off target data available for this crispr