ID: 1164511794

View in Genome Browser
Species Human (GRCh38)
Location 19:28903682-28903704
Sequence GGCAAGTACCTGCCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164511794_1164511796 6 Left 1164511794 19:28903682-28903704 CCAGCTGGAGGCAGGTACTTGCC No data
Right 1164511796 19:28903711-28903733 TTGATGAGCTAAGACCAGAGAGG No data
1164511794_1164511797 10 Left 1164511794 19:28903682-28903704 CCAGCTGGAGGCAGGTACTTGCC No data
Right 1164511797 19:28903715-28903737 TGAGCTAAGACCAGAGAGGCAGG No data
1164511794_1164511798 11 Left 1164511794 19:28903682-28903704 CCAGCTGGAGGCAGGTACTTGCC No data
Right 1164511798 19:28903716-28903738 GAGCTAAGACCAGAGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164511794 Original CRISPR GGCAAGTACCTGCCTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr