ID: 1164512865

View in Genome Browser
Species Human (GRCh38)
Location 19:28911799-28911821
Sequence GCTGCGCATTTGTTGCGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164512865_1164512869 4 Left 1164512865 19:28911799-28911821 CCAGACCGCAACAAATGCGCAGC No data
Right 1164512869 19:28911826-28911848 AATCATCTCCCAGCCCACCAGGG No data
1164512865_1164512868 3 Left 1164512865 19:28911799-28911821 CCAGACCGCAACAAATGCGCAGC No data
Right 1164512868 19:28911825-28911847 AAATCATCTCCCAGCCCACCAGG No data
1164512865_1164512875 25 Left 1164512865 19:28911799-28911821 CCAGACCGCAACAAATGCGCAGC No data
Right 1164512875 19:28911847-28911869 GGTACACACCACCCTTCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164512865 Original CRISPR GCTGCGCATTTGTTGCGGTC TGG (reversed) Intergenic