ID: 1164512868

View in Genome Browser
Species Human (GRCh38)
Location 19:28911825-28911847
Sequence AAATCATCTCCCAGCCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164512863_1164512868 28 Left 1164512863 19:28911774-28911796 CCTCAAGTTCTGCTTTCTAGGGA No data
Right 1164512868 19:28911825-28911847 AAATCATCTCCCAGCCCACCAGG No data
1164512866_1164512868 -2 Left 1164512866 19:28911804-28911826 CCGCAACAAATGCGCAGCCTAAA No data
Right 1164512868 19:28911825-28911847 AAATCATCTCCCAGCCCACCAGG No data
1164512864_1164512868 4 Left 1164512864 19:28911798-28911820 CCCAGACCGCAACAAATGCGCAG No data
Right 1164512868 19:28911825-28911847 AAATCATCTCCCAGCCCACCAGG No data
1164512865_1164512868 3 Left 1164512865 19:28911799-28911821 CCAGACCGCAACAAATGCGCAGC No data
Right 1164512868 19:28911825-28911847 AAATCATCTCCCAGCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164512868 Original CRISPR AAATCATCTCCCAGCCCACC AGG Intergenic