ID: 1164512875

View in Genome Browser
Species Human (GRCh38)
Location 19:28911847-28911869
Sequence GGTACACACCACCCTTCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164512864_1164512875 26 Left 1164512864 19:28911798-28911820 CCCAGACCGCAACAAATGCGCAG No data
Right 1164512875 19:28911847-28911869 GGTACACACCACCCTTCGCCAGG No data
1164512867_1164512875 3 Left 1164512867 19:28911821-28911843 CCTAAAATCATCTCCCAGCCCAC No data
Right 1164512875 19:28911847-28911869 GGTACACACCACCCTTCGCCAGG No data
1164512865_1164512875 25 Left 1164512865 19:28911799-28911821 CCAGACCGCAACAAATGCGCAGC No data
Right 1164512875 19:28911847-28911869 GGTACACACCACCCTTCGCCAGG No data
1164512866_1164512875 20 Left 1164512866 19:28911804-28911826 CCGCAACAAATGCGCAGCCTAAA No data
Right 1164512875 19:28911847-28911869 GGTACACACCACCCTTCGCCAGG No data
1164512870_1164512875 -10 Left 1164512870 19:28911834-28911856 CCCAGCCCACCAGGGTACACACC No data
Right 1164512875 19:28911847-28911869 GGTACACACCACCCTTCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164512875 Original CRISPR GGTACACACCACCCTTCGCC AGG Intergenic