ID: 1164515727

View in Genome Browser
Species Human (GRCh38)
Location 19:28933836-28933858
Sequence CTGCCTACAGAAATGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164515725_1164515727 1 Left 1164515725 19:28933812-28933834 CCAATCAGTCACTGTAGGCTCCT No data
Right 1164515727 19:28933836-28933858 CTGCCTACAGAAATGAAGCCTGG No data
1164515722_1164515727 9 Left 1164515722 19:28933804-28933826 CCATGCCTCCAATCAGTCACTGT No data
Right 1164515727 19:28933836-28933858 CTGCCTACAGAAATGAAGCCTGG No data
1164515724_1164515727 4 Left 1164515724 19:28933809-28933831 CCTCCAATCAGTCACTGTAGGCT No data
Right 1164515727 19:28933836-28933858 CTGCCTACAGAAATGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164515727 Original CRISPR CTGCCTACAGAAATGAAGCC TGG Intergenic
No off target data available for this crispr