ID: 1164520190

View in Genome Browser
Species Human (GRCh38)
Location 19:28973187-28973209
Sequence CAGTGACACCAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164520183_1164520190 6 Left 1164520183 19:28973158-28973180 CCTGACAATTTGCAAAGATTTCG No data
Right 1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164520190 Original CRISPR CAGTGACACCAGAGGGAGGA GGG Intergenic
No off target data available for this crispr