ID: 1164520902

View in Genome Browser
Species Human (GRCh38)
Location 19:28978614-28978636
Sequence GTTCCATTTTTACATGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164520902_1164520903 1 Left 1164520902 19:28978614-28978636 CCATCAACATGTAAAAATGGAAC No data
Right 1164520903 19:28978638-28978660 CTTAGTGAAAATAATAAATTAGG No data
1164520902_1164520904 18 Left 1164520902 19:28978614-28978636 CCATCAACATGTAAAAATGGAAC No data
Right 1164520904 19:28978655-28978677 ATTAGGAAAAATAGCTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164520902 Original CRISPR GTTCCATTTTTACATGTTGA TGG (reversed) Intergenic
No off target data available for this crispr