ID: 1164526533

View in Genome Browser
Species Human (GRCh38)
Location 19:29017321-29017343
Sequence CCCTCCATGGAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164526533_1164526542 -2 Left 1164526533 19:29017321-29017343 CCATCCTCCTTCTCCATGGAGGG No data
Right 1164526542 19:29017342-29017364 GGGGTTAGGCTCCAGGCCCTAGG No data
1164526533_1164526547 14 Left 1164526533 19:29017321-29017343 CCATCCTCCTTCTCCATGGAGGG No data
Right 1164526547 19:29017358-29017380 CCCTAGGAGAGCCAGGCTAAGGG No data
1164526533_1164526550 24 Left 1164526533 19:29017321-29017343 CCATCCTCCTTCTCCATGGAGGG No data
Right 1164526550 19:29017368-29017390 GCCAGGCTAAGGGAAGAGATGGG No data
1164526533_1164526545 13 Left 1164526533 19:29017321-29017343 CCATCCTCCTTCTCCATGGAGGG No data
Right 1164526545 19:29017357-29017379 GCCCTAGGAGAGCCAGGCTAAGG No data
1164526533_1164526541 -9 Left 1164526533 19:29017321-29017343 CCATCCTCCTTCTCCATGGAGGG No data
Right 1164526541 19:29017335-29017357 CATGGAGGGGGTTAGGCTCCAGG No data
1164526533_1164526543 7 Left 1164526533 19:29017321-29017343 CCATCCTCCTTCTCCATGGAGGG No data
Right 1164526543 19:29017351-29017373 CTCCAGGCCCTAGGAGAGCCAGG No data
1164526533_1164526549 23 Left 1164526533 19:29017321-29017343 CCATCCTCCTTCTCCATGGAGGG No data
Right 1164526549 19:29017367-29017389 AGCCAGGCTAAGGGAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164526533 Original CRISPR CCCTCCATGGAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr