ID: 1164529207

View in Genome Browser
Species Human (GRCh38)
Location 19:29035240-29035262
Sequence CTGTTTCCTCAGAAGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164529207_1164529212 30 Left 1164529207 19:29035240-29035262 CCTCTGTGCTTCTGAGGAAACAG No data
Right 1164529212 19:29035293-29035315 TATAAGGACACTGGTCCTATTGG 0: 2
1: 33
2: 204
3: 816
4: 1668
1164529207_1164529210 21 Left 1164529207 19:29035240-29035262 CCTCTGTGCTTCTGAGGAAACAG No data
Right 1164529210 19:29035284-29035306 TCCTTTTCTTATAAGGACACTGG No data
1164529207_1164529209 14 Left 1164529207 19:29035240-29035262 CCTCTGTGCTTCTGAGGAAACAG No data
Right 1164529209 19:29035277-29035299 TCTCTCTTCCTTTTCTTATAAGG 0: 8
1: 69
2: 251
3: 666
4: 1635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164529207 Original CRISPR CTGTTTCCTCAGAAGCACAG AGG (reversed) Intergenic
No off target data available for this crispr