ID: 1164531025

View in Genome Browser
Species Human (GRCh38)
Location 19:29048340-29048362
Sequence CTGCTCACTCGTACCCCAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164531025_1164531027 1 Left 1164531025 19:29048340-29048362 CCGCTTGGGGTACGAGTGAGCAG No data
Right 1164531027 19:29048364-29048386 GGAGCATCCCAGCAGAGAAAAGG No data
1164531025_1164531031 25 Left 1164531025 19:29048340-29048362 CCGCTTGGGGTACGAGTGAGCAG No data
Right 1164531031 19:29048388-29048410 AGCTTAAGTTCACAGCCGGCTGG No data
1164531025_1164531030 21 Left 1164531025 19:29048340-29048362 CCGCTTGGGGTACGAGTGAGCAG No data
Right 1164531030 19:29048384-29048406 AGGAAGCTTAAGTTCACAGCCGG No data
1164531025_1164531032 30 Left 1164531025 19:29048340-29048362 CCGCTTGGGGTACGAGTGAGCAG No data
Right 1164531032 19:29048393-29048415 AAGTTCACAGCCGGCTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164531025 Original CRISPR CTGCTCACTCGTACCCCAAG CGG (reversed) Intergenic
No off target data available for this crispr