ID: 1164533836

View in Genome Browser
Species Human (GRCh38)
Location 19:29069387-29069409
Sequence CCTCTGAGGGACCCCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164533831_1164533836 -9 Left 1164533831 19:29069373-29069395 CCCATCAGCAAACACCTCTGAGG No data
Right 1164533836 19:29069387-29069409 CCTCTGAGGGACCCCAAGCCAGG No data
1164533833_1164533836 -10 Left 1164533833 19:29069374-29069396 CCATCAGCAAACACCTCTGAGGG No data
Right 1164533836 19:29069387-29069409 CCTCTGAGGGACCCCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164533836 Original CRISPR CCTCTGAGGGACCCCAAGCC AGG Intergenic