ID: 1164535597

View in Genome Browser
Species Human (GRCh38)
Location 19:29084519-29084541
Sequence AGACTGCAACCACCTAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164535597_1164535600 12 Left 1164535597 19:29084519-29084541 CCAATTCTAGGTGGTTGCAGTCT No data
Right 1164535600 19:29084554-29084576 ATTGAAGAAGTAGCTGAAAGAGG No data
1164535597_1164535601 16 Left 1164535597 19:29084519-29084541 CCAATTCTAGGTGGTTGCAGTCT No data
Right 1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164535597 Original CRISPR AGACTGCAACCACCTAGAAT TGG (reversed) Intergenic
No off target data available for this crispr