ID: 1164536158

View in Genome Browser
Species Human (GRCh38)
Location 19:29087842-29087864
Sequence CACATGAAGGAGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164536152_1164536158 8 Left 1164536152 19:29087811-29087833 CCTGGGTGTGAAATCACACAGGA No data
Right 1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG No data
1164536149_1164536158 25 Left 1164536149 19:29087794-29087816 CCAAGGAGGGGCAAGGGCCTGGG No data
Right 1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164536158 Original CRISPR CACATGAAGGAGAAGGAGAC AGG Intergenic
No off target data available for this crispr