ID: 1164537122 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:29094054-29094076 |
Sequence | CACGGCTATCTGGCAGGCTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1164537119_1164537122 | -6 | Left | 1164537119 | 19:29094037-29094059 | CCAGCTCTGGATATGAACACGGC | No data | ||
Right | 1164537122 | 19:29094054-29094076 | CACGGCTATCTGGCAGGCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1164537122 | Original CRISPR | CACGGCTATCTGGCAGGCTT TGG | Intergenic | ||