ID: 1164537123

View in Genome Browser
Species Human (GRCh38)
Location 19:29094062-29094084
Sequence TCTGGCAGGCTTTGGCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164537119_1164537123 2 Left 1164537119 19:29094037-29094059 CCAGCTCTGGATATGAACACGGC No data
Right 1164537123 19:29094062-29094084 TCTGGCAGGCTTTGGCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164537123 Original CRISPR TCTGGCAGGCTTTGGCCTGC CGG Intergenic
No off target data available for this crispr