ID: 1164537277

View in Genome Browser
Species Human (GRCh38)
Location 19:29095248-29095270
Sequence TGCCCTGCAGTCTTTTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164537277_1164537278 8 Left 1164537277 19:29095248-29095270 CCTCTAGAAAAGACTGCAGGGCA No data
Right 1164537278 19:29095279-29095301 ACCCCATATAGAGTGTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164537277 Original CRISPR TGCCCTGCAGTCTTTTCTAG AGG (reversed) Intergenic
No off target data available for this crispr