ID: 1164538761

View in Genome Browser
Species Human (GRCh38)
Location 19:29106582-29106604
Sequence GACACAGGTGTGTTCAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164538761_1164538769 2 Left 1164538761 19:29106582-29106604 CCGCCCCTGAACACACCTGTGTC No data
Right 1164538769 19:29106607-29106629 GGAAGCTCACCTTCTAGACAGGG No data
1164538761_1164538774 17 Left 1164538761 19:29106582-29106604 CCGCCCCTGAACACACCTGTGTC No data
Right 1164538774 19:29106622-29106644 AGACAGGGGCTGGGCCTGAGAGG No data
1164538761_1164538772 8 Left 1164538761 19:29106582-29106604 CCGCCCCTGAACACACCTGTGTC No data
Right 1164538772 19:29106613-29106635 TCACCTTCTAGACAGGGGCTGGG No data
1164538761_1164538768 1 Left 1164538761 19:29106582-29106604 CCGCCCCTGAACACACCTGTGTC No data
Right 1164538768 19:29106606-29106628 GGGAAGCTCACCTTCTAGACAGG No data
1164538761_1164538771 7 Left 1164538761 19:29106582-29106604 CCGCCCCTGAACACACCTGTGTC No data
Right 1164538771 19:29106612-29106634 CTCACCTTCTAGACAGGGGCTGG No data
1164538761_1164538770 3 Left 1164538761 19:29106582-29106604 CCGCCCCTGAACACACCTGTGTC No data
Right 1164538770 19:29106608-29106630 GAAGCTCACCTTCTAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164538761 Original CRISPR GACACAGGTGTGTTCAGGGG CGG (reversed) Intergenic
No off target data available for this crispr