ID: 1164550890

View in Genome Browser
Species Human (GRCh38)
Location 19:29211786-29211808
Sequence CAGAGTAAAAAGAAAAGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 920
Summary {0: 1, 1: 0, 2: 4, 3: 89, 4: 826}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164550884_1164550890 13 Left 1164550884 19:29211750-29211772 CCATGAAGAAAGTGCAGAGCCCA 0: 1
1: 0
2: 3
3: 21
4: 310
Right 1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG 0: 1
1: 0
2: 4
3: 89
4: 826
1164550887_1164550890 -6 Left 1164550887 19:29211769-29211791 CCCAGGGTGAATGAAGACAGAGT 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG 0: 1
1: 0
2: 4
3: 89
4: 826
1164550888_1164550890 -7 Left 1164550888 19:29211770-29211792 CCAGGGTGAATGAAGACAGAGTA 0: 1
1: 0
2: 1
3: 19
4: 201
Right 1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG 0: 1
1: 0
2: 4
3: 89
4: 826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164550890 Original CRISPR CAGAGTAAAAAGAAAAGTGG CGG Intronic
900161424 1:1225815-1225837 CAGAGCAAAAAGCAAAAAGGTGG + Intronic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901659874 1:10792352-10792374 CAAAGTAAATGGAAATGTGGAGG + Intronic
901871878 1:12143059-12143081 CAGAGTCAAAAGGGAAGTCGAGG + Exonic
902801523 1:18832978-18833000 CAGAAAAAAAAAAAGAGTGGGGG - Intergenic
903334374 1:22615131-22615153 AAGAGAAAAAAGAAATCTGGAGG - Intergenic
903452090 1:23461020-23461042 GACAGTAAAAAGATCAGTGGTGG + Intronic
904476987 1:30771725-30771747 CAAAGGAAAAAAAAAAGTGAGGG - Intergenic
904713289 1:32447827-32447849 CCGAGAAGAAAGAAAAGGGGGGG + Intergenic
905536363 1:38725269-38725291 AAGTGTAAAAAGTAAAGTAGAGG + Intergenic
905947322 1:41914548-41914570 AAGAGGAAAAACAAAAGTAGAGG - Intronic
906568949 1:46820147-46820169 CAGAGAACAAAGGACAGTGGGGG - Intergenic
906800805 1:48735422-48735444 CAGAGGAGAAAGAAGAGAGGAGG + Intronic
907057203 1:51380545-51380567 AAGAGTAAAAGGAAATGAGGAGG + Intronic
907226263 1:52949939-52949961 AAGTGTAAAAAGTAAAGTAGAGG - Intronic
907236265 1:53051661-53051683 CAGAATAAAGAGAAACGTTGGGG + Exonic
907634731 1:56122630-56122652 CTGAGCAAAAAGAAAGCTGGAGG - Intergenic
907964435 1:59315470-59315492 CTGAGGAAAAGGAAAAGAGGGGG - Intronic
908030647 1:59995692-59995714 AAGAGTCAAAAGGAAAGTGAAGG - Intronic
908121894 1:60993735-60993757 AAGACTAAAAGGAAAAGAGGTGG + Intronic
908154307 1:61336685-61336707 GAGAGTAAAAAGATCAGTGGTGG - Intronic
908227861 1:62074195-62074217 CAAATTAAAAAAAATAGTGGGGG + Intronic
908619636 1:65963184-65963206 CCAAGTAAAAATAAAGGTGGGGG - Intronic
909013146 1:70356046-70356068 CAGACTGAGAAGAAAATTGGAGG - Intronic
909113905 1:71510383-71510405 GAAAGTAAATAGAAAAGAGGAGG + Intronic
909432073 1:75600010-75600032 TAGAGTAAAAAATAAATTGGAGG + Intronic
909443345 1:75722246-75722268 CAGTGTAAAAAGTGAAGTAGAGG + Intergenic
909818160 1:80023918-80023940 CAAAGTAAAAATAAAAAAGGTGG - Intergenic
909832314 1:80207990-80208012 CAGACTGAAAAAAAAAGTGCAGG - Intergenic
910462153 1:87459106-87459128 CAGAGGAAAGAGAAAAATTGAGG + Intergenic
910549193 1:88456612-88456634 TGGAGTTAAAAGGAAAGTGGAGG - Intergenic
910606600 1:89092104-89092126 CAGAGGAAAAAGAAAATTGGAGG + Intergenic
910746027 1:90575709-90575731 AAAAAGAAAAAGAAAAGTGGGGG + Intergenic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
911036372 1:93553546-93553568 CAAAATAAAAAGACAATTGGGGG - Exonic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
914784737 1:150818040-150818062 CAGAGTAGACAGTAAAGAGGGGG + Intronic
914836372 1:151210193-151210215 TCGAGGAAAAAAAAAAGTGGGGG - Intronic
915119253 1:153618264-153618286 AAAAGAAAAAAGAAAAGTAGGGG - Intergenic
915125616 1:153661554-153661576 CAGCTTAAAAAAAAAAGTAGAGG - Exonic
915296341 1:154924449-154924471 CAAAGAAAAAAAAAAAGCGGGGG + Intergenic
915520330 1:156438348-156438370 CACAGAAATAAGGAAAGTGGGGG - Intergenic
916443584 1:164851600-164851622 CTGAATAATAAGAAAAGGGGAGG - Exonic
916878103 1:168992060-168992082 CATAGTAAATAGTAAAGAGGAGG + Intergenic
917077359 1:171219222-171219244 CATTGTAAAAAGTAAAGTAGAGG + Intergenic
917166112 1:172115126-172115148 CACAGTAACAAAAAAAGTGCAGG + Intronic
917713002 1:177706395-177706417 TAGAGGAAAAAGAATAGAGGAGG - Intergenic
917996362 1:180442992-180443014 AAAAGGAAAAAAAAAAGTGGGGG - Intronic
918018062 1:180657728-180657750 CTGAGCAAAAAGAAAACTGGAGG - Intronic
918034620 1:180855662-180855684 CAAAAAAAAAAAAAAAGTGGGGG + Intronic
918367057 1:183819463-183819485 CACAGAATAAAGAAAAGTGTCGG - Intronic
918817198 1:189202806-189202828 CAGAGTAAAAATAAAAGCTATGG + Intergenic
919008412 1:191928950-191928972 GAGAGGAAAAAGAAGAGTGGGGG + Intergenic
919584630 1:199421186-199421208 CAGAGTAGATAGAAAAGATGAGG + Intergenic
920004198 1:202820819-202820841 CAGGGGAAAAAAAAAAGGGGTGG - Intronic
920288797 1:204901765-204901787 CAGTGAAAAAGGAAAAGTTGAGG + Intronic
920740665 1:208578536-208578558 CAGAGTAAAAGGAATAGTGGGGG - Intergenic
920944710 1:210517412-210517434 CTGAGTAAGATGAAAAGTGCTGG - Intronic
921144806 1:212343884-212343906 GGGAGCAAAAAGAAAACTGGTGG + Intronic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921660803 1:217799859-217799881 CAGACTTAAAAAAAAAGTTGAGG - Intronic
921708301 1:218348146-218348168 AAGAAGAAAAAGAAAAGTGGGGG + Intronic
921798630 1:219376520-219376542 CAGAGTGAAAAGACAAGTCATGG + Intergenic
922067703 1:222159803-222159825 CACATTTAAGAGAAAAGTGGTGG + Intergenic
922205128 1:223439490-223439512 CAGAGTAAAAGGCAATGAGGTGG - Intergenic
922433577 1:225581135-225581157 CAGAAAAAAAAGAAAAATGTGGG + Intronic
922447387 1:225708942-225708964 CAAAAAAAAAAAAAAAGTGGGGG + Intergenic
922481871 1:225944932-225944954 CAGAGAAGATAGCAAAGTGGAGG + Intergenic
922887090 1:229028450-229028472 AAGTTTAAAAATAAAAGTGGGGG - Intergenic
923346909 1:233062933-233062955 CAGAATAAAAACAAAAGAAGAGG + Intronic
923497195 1:234535932-234535954 GAGTCTAAAAACAAAAGTGGAGG + Intergenic
923649494 1:235860517-235860539 GACAGTAAAAAGATTAGTGGTGG - Intronic
923877002 1:238060007-238060029 CAGAGTAAAAGAACAAGGGGAGG - Intergenic
923935172 1:238751933-238751955 CAAAGGAAAAAGAAAAATGTAGG + Intergenic
924367303 1:243308883-243308905 CTGAGCACAAAGAAAAGTAGGGG - Intronic
924887827 1:248238996-248239018 CAGAGAAAAAAGGAAGGTGTGGG - Exonic
1062892276 10:1072685-1072707 CAAAGTAAAAAAAAAAGGGTTGG + Intronic
1063167637 10:3478535-3478557 TTGAGTAAAAAAAAAAGTGTTGG - Intergenic
1063180957 10:3599450-3599472 AAGAAAGAAAAGAAAAGTGGAGG + Intergenic
1063186286 10:3654670-3654692 TAGGGCAAAAAGAACAGTGGTGG - Intergenic
1063777891 10:9284811-9284833 CAGGGTAGAAAGAAAGGAGGTGG - Intergenic
1064177522 10:13087776-13087798 CAGAGTACATAGGAAAGCGGCGG - Intronic
1064378169 10:14815885-14815907 CAGACAAAAAAAAAAAGAGGAGG - Intergenic
1064456043 10:15488375-15488397 GTAAGTAAAAAGAAAAGTGATGG - Intergenic
1064817045 10:19277521-19277543 AACATTAAAAAGAAAAGAGGAGG - Intronic
1064995763 10:21295800-21295822 GAGAGTAAAAACAAGAGTAGCGG + Intergenic
1065171940 10:23039525-23039547 CAGAAAAAAAAGAAATGTGTTGG - Intergenic
1065211959 10:23412674-23412696 CAGATTTAAAAGAAAAATAGAGG + Intergenic
1065729505 10:28697834-28697856 CAAAGCCAAAAAAAAAGTGGGGG - Intergenic
1066576588 10:36832413-36832435 CAGATAAAAAAAAAAAGGGGGGG + Intergenic
1067737744 10:48871467-48871489 CAGAAAAAAAAAAAAAGGGGGGG - Intronic
1067936526 10:50617005-50617027 CAAAGTATAAAGAAAAGTAGGGG + Intronic
1068002831 10:51356567-51356589 CAGAGGAAAAAGAGTAGGGGAGG - Intronic
1068135126 10:52945482-52945504 CAATGTAAAAAGTAAAGTAGAGG + Intergenic
1068166093 10:53334288-53334310 CAGAGTAAAAAGGAATCTGAAGG - Intergenic
1068200178 10:53774095-53774117 CAGAGTAGGAGGAAAAGAGGAGG + Intergenic
1068281956 10:54884134-54884156 CAGAGTAACAAGAAAACAGTGGG + Intronic
1068362641 10:55998655-55998677 CAGAGGAAATAGAAAAGACGGGG + Intergenic
1069567199 10:69471609-69471631 CAGAGTCGAAAGAGAAGGGGAGG - Intronic
1069586846 10:69612179-69612201 GACAGTAAAAAGATTAGTGGTGG + Intergenic
1070109594 10:73471815-73471837 GACAGTAAACAGCAAAGTGGTGG + Intronic
1070453256 10:76582919-76582941 TATTGTAAAAATAAAAGTGGAGG - Intergenic
1070656496 10:78275273-78275295 CAGAGAGAAAAGAAAACAGGTGG + Intergenic
1071066959 10:81647270-81647292 CAAAGGAAAATGAAAAGTGACGG - Intergenic
1071390422 10:85169440-85169462 CATAAAGAAAAGAAAAGTGGTGG + Intergenic
1071901277 10:90122681-90122703 CAGAGGAAAAGCAAAACTGGAGG - Intergenic
1072910443 10:99496424-99496446 CTGAGTAGAAGAAAAAGTGGAGG - Intergenic
1073261445 10:102193592-102193614 GAAAGTAAATAGAAAAGAGGAGG - Intergenic
1073315668 10:102579042-102579064 CTGCTTAAAAAGAAAAGTGAAGG + Intronic
1073771802 10:106743145-106743167 CAAAGAAAAGAGAGAAGTGGAGG + Intronic
1074862090 10:117518157-117518179 AAGTGTAAACAGAAAACTGGGGG + Intergenic
1075123549 10:119681791-119681813 AAAAAGAAAAAGAAAAGTGGGGG - Intergenic
1075191333 10:120311856-120311878 TGGAGTCAAAAGACAAGTGGTGG + Intergenic
1075302842 10:121340748-121340770 GAGTGGAAAAAGACAAGTGGAGG + Intergenic
1075476754 10:122742152-122742174 CAGAGTAAGAAGAAAAGAGATGG + Intergenic
1075780951 10:125016756-125016778 TAGAGAAGAAAGAAGAGTGGAGG - Intronic
1075892104 10:125960940-125960962 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1076425084 10:130361965-130361987 GAGAGAAAGAAGAAAAGAGGAGG + Intergenic
1076654705 10:132016115-132016137 CACTGTAAAAAGTAAAGTAGAGG - Intergenic
1078196274 11:9139536-9139558 CACTGTAAAAAGAAAACTAGAGG - Exonic
1078289283 11:9990868-9990890 CAGAGTATGAAGAACAGAGGAGG + Intronic
1078571870 11:12465551-12465573 GAGAGTAAAAAGATAAATGGGGG - Intronic
1078611300 11:12821907-12821929 AAGAGGAAAGAGAAAAGGGGAGG - Intronic
1079473365 11:20802021-20802043 CTGAGCAAAAAGAAAACTGGAGG - Intronic
1079827601 11:25216978-25217000 GAGAACAAAAAGAAAAGTTGAGG + Intergenic
1079997570 11:27311049-27311071 AAGAGAAAAGAAAAAAGTGGGGG + Intergenic
1080529468 11:33161163-33161185 CAGGGTATATAGAAGAGTGGTGG - Intronic
1080819012 11:35787494-35787516 CAGGATTAAAAAAAAAGTGGGGG - Intronic
1080880423 11:36314584-36314606 CAGAGCAAAAACAACACTGGAGG - Intronic
1081318889 11:41666284-41666306 CAGAGTAAAATGAAAATGTGAGG - Intergenic
1081491254 11:43570806-43570828 AAAAGTAGAAAGAAAAGGGGAGG - Intronic
1081797022 11:45827653-45827675 CAGAGTAAAAGGAAAAGAAGGGG - Intergenic
1081811486 11:45916667-45916689 CTCAGAAAAAAGAAAAGTGGAGG - Intronic
1082975875 11:59071080-59071102 CAGTTTAAAGAGGAAAGTGGGGG + Intergenic
1083558619 11:63653800-63653822 GACAGTAAAAAGATCAGTGGAGG + Intronic
1083657614 11:64237310-64237332 CAGAGGAAAAGGGAAAGTGGGGG - Intronic
1084214013 11:67637854-67637876 CATTGTAAAAAGTAAAGTAGAGG - Intronic
1084396375 11:68913482-68913504 CTGAGGAAAAAAAAAAGAGGAGG - Intronic
1084857891 11:72000554-72000576 CTGAGTAAGAAGCACAGTGGTGG + Exonic
1085065265 11:73489504-73489526 CAAAAAAAAAAAAAAAGTGGGGG - Intronic
1085252609 11:75153494-75153516 CAAAGTAAACAGCAGAGTGGAGG + Intronic
1085356434 11:75842404-75842426 CACAGTAAAAGGAAAAGTAATGG - Intronic
1085443153 11:76581111-76581133 CAGGGTATAAAGAAAAACGGTGG - Intergenic
1085467253 11:76732509-76732531 TCCAGTAAAAAGAAAAGTTGGGG - Intergenic
1085515654 11:77110439-77110461 CAGAGTTGACAGAAAAGTGGGGG + Intronic
1085554115 11:77403985-77404007 AAGAGTAACAAGGGAAGTGGGGG - Intronic
1085555549 11:77417429-77417451 AATAGTAAAAAGATAAGTGGCGG + Intronic
1085715135 11:78865750-78865772 CAAAGAAAAAAGCAAAGTGTCGG - Intronic
1086761710 11:90639384-90639406 AAGAGAAAAAAGGAGAGTGGGGG + Intergenic
1086934081 11:92724972-92724994 CACAGCAATAAGAAAAGTTGAGG + Intronic
1087577591 11:100009446-100009468 AAGTGTAAAAAAAAAAATGGAGG + Intronic
1087910405 11:103746451-103746473 CAGAGAAAAAAGAAAACTTCAGG - Intergenic
1088028719 11:105219669-105219691 CAGGTTATAAAGAGAAGTGGGGG + Intergenic
1088102871 11:106174380-106174402 CTGTGTAAAAAGTAAAGTTGAGG - Intergenic
1088267623 11:108002744-108002766 CAGAATCATTAGAAAAGTGGAGG - Intergenic
1089794476 11:120969258-120969280 CAGAGTAAAAGAAAATGGGGGGG + Intronic
1089895876 11:121929403-121929425 CAGAGTGATCAGAAAAGTCGTGG - Intergenic
1090327085 11:125898225-125898247 CAGTTTAAAAAGAAAAATAGTGG + Intronic
1090393021 11:126401786-126401808 CAGAATAAAAACAAGAGTGGAGG + Intronic
1090563189 11:127956370-127956392 CAAAAGAAAAAGAAAAGTGAAGG + Intergenic
1090655409 11:128839893-128839915 CAGAGAAAACAGAAAAGCTGAGG + Exonic
1090683722 11:129091019-129091041 CAGAATAAAAAGATAAGGGAGGG + Intronic
1091320244 11:134644466-134644488 GAGAGTAGAAAGAAGAGTGAAGG - Intergenic
1092267626 12:6994897-6994919 CAGTGTAGCAAGAATAGTGGAGG - Intronic
1092334607 12:7619362-7619384 GAAAGTAAAAAGAAAATTAGAGG - Intergenic
1092553600 12:9530992-9531014 AAAAATAAAAAAAAAAGTGGGGG - Intergenic
1092622750 12:10290725-10290747 CAGAGTAACAAAATAATTGGTGG + Intergenic
1093082524 12:14829358-14829380 CAGAGTATAAAGAAATCTTGTGG - Exonic
1093152765 12:15642966-15642988 CACATTAAAAAGAAAATTGGTGG + Intronic
1093206623 12:16259287-16259309 GAAAGGAAAAAGAAAAGGGGAGG - Intronic
1093315301 12:17642689-17642711 CAAAGTATAAAGAAAAATTGGGG - Intergenic
1093356488 12:18173786-18173808 CAGAGAAGAAAGAAAAGGGGGGG - Intronic
1093514815 12:19973269-19973291 AAGAGTCAGAAGAAAAATGGTGG - Intergenic
1093533382 12:20194322-20194344 CAGAGTCAAAACCAAAGTGCTGG + Intergenic
1093606980 12:21103988-21104010 CAGGGAAAAAAGAAAACTGCTGG - Intronic
1094518498 12:31159631-31159653 AAAAATAAAAAAAAAAGTGGGGG + Intergenic
1094679541 12:32656102-32656124 CACATTAAAAAGATCAGTGGTGG + Intergenic
1095327938 12:40920493-40920515 GACAGGAAAAAAAAAAGTGGGGG + Intronic
1095594412 12:43942614-43942636 AAGAGTAAAAAAAAAAGAGCGGG - Intronic
1096188406 12:49599042-49599064 TAGAGCAAAAAGAGAAATGGAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096614211 12:52822594-52822616 CAGAGAGGAAAGAAAAGGGGAGG - Intronic
1097126475 12:56780229-56780251 GGGTGTAAAAAGTAAAGTGGAGG + Intronic
1097245195 12:57604325-57604347 CATAGTAAAAAGAAAAGCATTGG - Intergenic
1097352812 12:58567144-58567166 CACAGTGAAAAAAAAAGGGGGGG - Intronic
1097424906 12:59431952-59431974 CAGAGTAAAAGAAAAAATGCAGG + Intergenic
1097437453 12:59568898-59568920 CAGAGAAAATAGAAGAGTCGAGG - Intergenic
1098088843 12:66879267-66879289 AAAAGGAAAAAAAAAAGTGGAGG + Intergenic
1098869989 12:75806312-75806334 TAGAGTAAAAAAAAAATTGGAGG + Intergenic
1099156800 12:79187393-79187415 CAAAGTGAAAAAGAAAGTGGAGG - Intronic
1099282520 12:80669461-80669483 AAGGGTAAAAAAAAAAGGGGGGG + Exonic
1099436336 12:82650278-82650300 CAGATTAAAAATAAAAATGATGG - Intergenic
1099547473 12:84002975-84002997 AACAGTCAAAAGAAAACTGGAGG - Intergenic
1099585535 12:84508296-84508318 CAGAGTACAGAGAAAAGAGCAGG + Intergenic
1099781575 12:87202383-87202405 CACAGTAGAAAGGAATGTGGTGG + Intergenic
1099945905 12:89244122-89244144 AAGAGAAAGAGGAAAAGTGGGGG - Intergenic
1100133244 12:91521832-91521854 CAGAGTAGAAAGAGAAGGAGGGG + Intergenic
1100288687 12:93192535-93192557 TGGATTAAGAAGAAAAGTGGTGG + Intergenic
1100802965 12:98252381-98252403 GAGAGTGGAAAGAGAAGTGGGGG - Intergenic
1100962558 12:99979358-99979380 CAGAGTAAAAGGAAAACTGTGGG + Intronic
1101109946 12:101476131-101476153 CATAATAAAAAGAACTGTGGTGG - Intronic
1101676115 12:106918034-106918056 AAAAGTAAAGAGCAAAGTGGCGG - Intergenic
1102431013 12:112882858-112882880 TAGAGTAAAATGAAAAATGTTGG + Intronic
1102831733 12:116008514-116008536 CGGAGTCATCAGAAAAGTGGTGG - Exonic
1103274984 12:119704038-119704060 CAGTGGAAAAAAAAAAGGGGGGG - Intronic
1103313819 12:120035033-120035055 CAGAGTAAGAATAAAAGGAGAGG + Intronic
1104962314 12:132494059-132494081 CAGAGTAGAAAGTCAAGCGGGGG - Intronic
1105007078 12:132728226-132728248 CAAAATAAAAAAAAAAGTAGTGG - Intronic
1105392164 13:19990330-19990352 CAAAGTAAGAAGCAAAGAGGAGG - Intronic
1105791256 13:23801600-23801622 TAGACTATAAAGAAAAGTGAGGG - Intronic
1106428937 13:29660772-29660794 CATTGTAAAAAGTAAAGTAGAGG - Intergenic
1106993295 13:35450008-35450030 CAGAGTAAAAACACATGTTGAGG - Intronic
1107156533 13:37173663-37173685 CAGAAAAAAAAAAAAAATGGTGG - Intergenic
1107706416 13:43111124-43111146 CAGCGTAAAGTCAAAAGTGGAGG + Exonic
1108288367 13:48931972-48931994 CAGAATAATAAGAAAATTGAAGG + Intergenic
1108317411 13:49250269-49250291 CACAGTAAAATGAAAAGAGTAGG - Intronic
1108352954 13:49603755-49603777 TAGAGTTAAAAAAAAAGGGGGGG + Intergenic
1108408976 13:50129259-50129281 CAGAGAAAAAAAAAAAAAGGTGG - Intronic
1108809670 13:54206064-54206086 AAGATTACAAAGAAGAGTGGAGG - Intergenic
1108852176 13:54744280-54744302 CACAGAAAAATGAATAGTGGAGG + Intergenic
1109069738 13:57749246-57749268 AATAGAAAAAAGAAAAGTGGAGG + Intergenic
1109342860 13:61084092-61084114 CAGAGTAGAAGGAAGAGTGGGGG + Intergenic
1109745185 13:66615250-66615272 AAGTGTAAAAAGTAAAGTAGAGG - Intronic
1110115598 13:71812084-71812106 CAGAGTAAAAATAAAAGATGTGG - Intronic
1110219014 13:73053198-73053220 CAGAGTAAAAATAAGTGTAGAGG + Intergenic
1110724142 13:78800180-78800202 GAGAGTAAAAAGACCAGTGGTGG - Intergenic
1111188862 13:84781678-84781700 CAGAGTAATAAGAACAGATGTGG - Intergenic
1111709899 13:91797967-91797989 CAGAGTAAATAGGAAAGTACAGG + Intronic
1111836758 13:93397756-93397778 CAGAGAAAAAAAAAAAGAGGAGG - Intronic
1111950730 13:94707255-94707277 GAGAGAAAAAAGAAAAGGGGGGG + Intergenic
1112177087 13:97036552-97036574 GAAAGAAAAAAGAAAAGGGGAGG + Intergenic
1112405347 13:99114792-99114814 CAGAGAATAAAGAAAAGAAGGGG + Intergenic
1112526066 13:100148422-100148444 CAGAGGAAAAAGTAGAGTAGGGG - Intronic
1112533696 13:100229299-100229321 AAGTGTAAAAAGTAAAGTAGAGG + Intronic
1112641354 13:101279155-101279177 CAGACATAAAAGAAAAGTGTAGG + Intronic
1112708673 13:102101701-102101723 CAAAGAAAAAAAAAAAGTTGGGG - Intronic
1112937009 13:104813415-104813437 CAGAGTAACTAGATAAGTTGTGG - Intergenic
1113275164 13:108720405-108720427 CAGAGAGAGAAGAAAAGTAGCGG - Intronic
1114397988 14:22384134-22384156 CAGAGGATAAAGCACAGTGGTGG + Intergenic
1114511059 14:23261461-23261483 TAGTGTAAAAAGTAAGGTGGAGG - Intronic
1114531321 14:23398314-23398336 AAGTGTAAGAAGAAAAGTAGAGG - Intronic
1114877877 14:26745047-26745069 CGGAAGAAAAAGAAAACTGGGGG - Intergenic
1114927799 14:27426674-27426696 TAGATTAAAAGCAAAAGTGGGGG + Intergenic
1114961730 14:27900187-27900209 CAGATTAAAAAAAAAAGAGATGG + Intergenic
1115034853 14:28844936-28844958 AAGAATAAAAAGAAAACTTGAGG - Intergenic
1116281235 14:42910966-42910988 CAGATAAAAAATAAAAGTAGAGG - Intergenic
1116347901 14:43819902-43819924 CAAAGAAAAATGAAAAGTGAAGG + Intergenic
1116438303 14:44920243-44920265 CAGAGTAACCAGATAAGTGATGG + Intergenic
1116688761 14:48077906-48077928 TAGAGTAAGAAGAAAAGGTGGGG - Intergenic
1116850460 14:49903774-49903796 CAAAAAAAAAAAAAAAGTGGGGG - Intergenic
1116880081 14:50158728-50158750 CAAAGTAAAAAGAAAAAGGGAGG - Intronic
1117089453 14:52235633-52235655 GGGAGTAAAGAGAGAAGTGGTGG + Intergenic
1117410493 14:55446410-55446432 GAGAGGAAAAAAAAAAGGGGGGG + Intronic
1117546172 14:56796309-56796331 AAGAATTAAAAGAAAAGGGGTGG + Intergenic
1117954772 14:61113999-61114021 CTGAGTCAGAAGAAAAGTGCTGG - Intergenic
1118023650 14:61745921-61745943 AAGATTAAAAAGTAAAGTTGTGG + Intronic
1118088448 14:62445511-62445533 CAGAGTAATAAGAAAAAGGAGGG - Intergenic
1118663578 14:68041800-68041822 CTTAGTAAAAAGAAAAGCAGCGG - Intronic
1120181087 14:81342866-81342888 CAGAGGAAAAAGAGTGGTGGTGG + Intronic
1120182021 14:81353644-81353666 CAGAGGAAAAAGAAAATCAGAGG + Intronic
1120993652 14:90398426-90398448 CAGAGAAAGCAGAAACGTGGAGG - Intronic
1121546068 14:94764650-94764672 AAGAGTAAGAGGAAAAGTGCAGG - Intergenic
1121903693 14:97719730-97719752 TAGAAAAAAAAAAAAAGTGGTGG + Intergenic
1122419348 14:101565253-101565275 GAGAGAAATAAAAAAAGTGGGGG - Intergenic
1122547943 14:102535057-102535079 CAGAGAAAAAAAAAAGGGGGGGG + Intergenic
1122764608 14:104057763-104057785 GACAGTAAAAAGATGAGTGGTGG - Intergenic
1124160464 15:27263943-27263965 AAGAAAAAAAAGAAAAGTGCTGG + Intronic
1124203045 15:27694765-27694787 AAGAGAAAAAGGAAAAGGGGCGG - Intergenic
1124876295 15:33597902-33597924 GACAGAAAAAAAAAAAGTGGGGG - Intronic
1125705607 15:41732950-41732972 AAAAGAAAAAAGAAAAGTAGAGG - Intronic
1126281594 15:46957975-46957997 CCCAATAAAAAGAACAGTGGTGG + Intergenic
1126472875 15:49034036-49034058 CAGAATGAAAAAAAAAGTGTTGG - Intronic
1126596202 15:50386485-50386507 GACAGTAAAAAGATCAGTGGTGG + Intergenic
1126917777 15:53484633-53484655 AAGAGTAAAAAAAAAAGAGTAGG + Intergenic
1127893466 15:63275238-63275260 GAGGGTAACAAGAAAACTGGGGG - Intergenic
1128050745 15:64662340-64662362 CAGAGGAAAAAAAAAAGATGGGG - Intronic
1128281988 15:66403356-66403378 AAGAGAATAAAGAAAAGTTGTGG + Intronic
1128345986 15:66852671-66852693 CAGAGTAAAATGAAATGAGGAGG - Intergenic
1128396060 15:67227322-67227344 CAAAGTAAAAAAAAAAATAGAGG - Intronic
1128998024 15:72311105-72311127 AAGAATAAAAAGAAATGGGGAGG - Intronic
1129060549 15:72857201-72857223 GAGAGTAGAAAGAAAAGTGAAGG + Intergenic
1129124509 15:73427079-73427101 CAGAGTAAGAAGAGAAAAGGAGG + Intergenic
1131620778 15:94065897-94065919 CAGAGGAAAAAAAAAAGGTGGGG + Intergenic
1131744595 15:95433419-95433441 AAAAGTCAAAAGAAAAGTGTTGG + Intergenic
1131783377 15:95884105-95884127 CAAAAAAAAAAAAAAAGTGGGGG + Intergenic
1131998840 15:98159934-98159956 AATAGAAAAAAAAAAAGTGGAGG - Intergenic
1132034200 15:98467001-98467023 AAGATTAAAAAGACAAGTGGCGG + Intronic
1132137435 15:99355760-99355782 CACAATAAAAAGCAAAGTAGTGG - Intronic
1133287594 16:4697819-4697841 CAGAGTCCAAGGAAAAGAGGGGG - Intronic
1133356142 16:5138337-5138359 GAAAGTAAAATGGAAAGTGGGGG + Intergenic
1135044550 16:19144531-19144553 CAGAGTAGACAAAAAAGTAGGGG - Intronic
1135086078 16:19475421-19475443 CAGAAAAAAAAAAAAAGTGTAGG + Intronic
1135512749 16:23101446-23101468 TGGAATCAAAAGAAAAGTGGAGG + Intronic
1135527882 16:23227978-23228000 AAGAAAAAAAAAAAAAGTGGAGG - Intergenic
1135693873 16:24569498-24569520 CAGAAAAAGAAGAAAAGGGGAGG + Exonic
1136673414 16:31877812-31877834 CAGGGCAAAAAAAAAAGTAGTGG - Intronic
1137224152 16:46486308-46486330 CAGTGAAAAAAGAAAACTGCAGG + Intergenic
1138301693 16:55935637-55935659 CAGAGTGAAAAGGAGTGTGGTGG - Intronic
1138585950 16:57970648-57970670 AGGAGGAAAAAGAAAAATGGGGG - Intronic
1138836743 16:60446476-60446498 CAGATTAAAAAGACAAATGTAGG - Intergenic
1139092804 16:63669237-63669259 CAGAATAAAAGGAAAAGAAGAGG + Intergenic
1139199598 16:64960472-64960494 CAGAGTGATAAGAAAAATTGAGG + Intronic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1140028302 16:71311993-71312015 CAAAAGAAAAAGGAAAGTGGAGG - Intergenic
1140346655 16:74219976-74219998 CAGAGGAAAAAGGAAATGGGTGG - Intergenic
1140702378 16:77592872-77592894 CAGTGTTAAAAGGAAAGTGAAGG - Intergenic
1141497215 16:84418565-84418587 CAGAGGAAAAATAACAGTGCTGG - Intronic
1142251979 16:88996237-88996259 CAGAATAAAATGGAAAGTGTGGG - Intergenic
1142523797 17:523474-523496 CAAAGTAAATAGGAAATTGGAGG - Intronic
1143332473 17:6147921-6147943 CAGAATAAAAAGAAATGGGGAGG - Intergenic
1143420466 17:6787533-6787555 CTGACAAAAAAAAAAAGTGGAGG - Exonic
1143493167 17:7295226-7295248 GAAAGAAAAAAGAAAAGTAGGGG - Intergenic
1143657479 17:8304271-8304293 CAGAGCAAAAAAAAAAGCTGGGG - Intergenic
1145742132 17:27283938-27283960 CAGTGTAATAGGAAAAGTGCTGG + Intergenic
1145861607 17:28215892-28215914 CACAGAGACAAGAAAAGTGGGGG - Intergenic
1146952070 17:36913615-36913637 CTCAGTAAAAATAAAACTGGGGG + Intergenic
1148865727 17:50627488-50627510 CAGAGTAAAAGCAAAAGGGATGG + Intergenic
1149100415 17:52899512-52899534 TAGAGTAAAATAAAAATTGGTGG - Exonic
1149161805 17:53702771-53702793 GAGAATAAGAATAAAAGTGGGGG + Intergenic
1149403284 17:56321115-56321137 CAAAGAAAAAAGAAAAGGGGTGG - Intronic
1149715404 17:58784498-58784520 CAAAAAAAAAAAAAAAGTGGTGG - Intronic
1150413051 17:64963052-64963074 CAAAAAAAAAAAAAAAGTGGGGG - Intergenic
1151771362 17:76164184-76164206 AAGAGTGGAAAGAAAAGTGCTGG + Intronic
1151920221 17:77148996-77149018 AAAAGAAAAAAGAAAAGAGGGGG - Intronic
1203167345 17_GL000205v2_random:110025-110047 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1153329468 18:3858874-3858896 AAATGTAAGAAGAAAAGTGGTGG + Intronic
1153396876 18:4632569-4632591 CAGAATCAAAAGGAAACTGGAGG + Intergenic
1153688006 18:7566468-7566490 CAGGGGAGAAAGAGAAGTGGGGG - Intergenic
1155331929 18:24727575-24727597 CAGAGTAGAAGGAAAGGCGGCGG - Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1155718120 18:28971965-28971987 CAAAGTAAAAACAAGAGTGGTGG + Intergenic
1155872720 18:31047186-31047208 CTGAGTAAAAAGAAGACTGATGG - Intergenic
1155975310 18:32122468-32122490 CACAGTAATAAGATAAGTAGTGG - Intronic
1156051875 18:32946337-32946359 GAGAGTTTGAAGAAAAGTGGTGG - Intronic
1156091971 18:33482430-33482452 AAGAGGAAAAAAAAAAGAGGTGG - Intergenic
1156354009 18:36325706-36325728 CAGAGTAAGAAGAAAAGAGAGGG - Intronic
1156685032 18:39634030-39634052 CAGAGAAGAAAGAAAAGATGTGG - Intergenic
1156735116 18:40246804-40246826 TAAAGTAAAAAAAAAAATGGAGG - Intergenic
1156753316 18:40488618-40488640 CAGATTAAAAAGAAAATTACTGG - Intergenic
1156831197 18:41493498-41493520 CCAAGTTAAAAAAAAAGTGGGGG - Intergenic
1156884708 18:42121653-42121675 CAGGGTAAAAAGTAGATTGGAGG - Intergenic
1157348020 18:46858097-46858119 CAGAGTACAGAGAAAAAAGGCGG + Intronic
1157412461 18:47474964-47474986 CAGTGTGAAAAGCAAAGTGAGGG - Intergenic
1157833409 18:50878212-50878234 CAGAATAAAATTAAAAGTGATGG - Intergenic
1157872628 18:51244726-51244748 CACTGTAAAAAGAAAAGTGCAGG - Intergenic
1158094221 18:53752762-53752784 CAGTGGAAGAACAAAAGTGGAGG - Intergenic
1158302374 18:56066295-56066317 GAAAGCAAAAATAAAAGTGGGGG - Intergenic
1158606825 18:58902929-58902951 CAGAGGAAAAAGAAAAACGAGGG - Intronic
1158638944 18:59186063-59186085 AAGATTAAAAAGAAAAGTTTTGG + Intergenic
1159858903 18:73622650-73622672 CACTGTAAAAAGAAAACTGCAGG + Intergenic
1160359264 18:78257241-78257263 CAGTGTGAAAAGAAAATTTGGGG - Intergenic
1160449785 18:78954757-78954779 AACAATAAAAATAAAAGTGGTGG - Intergenic
1161911914 19:7200243-7200265 CAGAGGAAACAGAAAAGAAGAGG + Intronic
1161957502 19:7504705-7504727 CAAAAAAAAAAAAAAAGTGGGGG + Intronic
1162237937 19:9322932-9322954 TACAGTAAAAAGTAAAGTAGAGG - Intergenic
1162287804 19:9752758-9752780 CAGCCTAAAAAGAAAAGTGCTGG - Intronic
1163456985 19:17412673-17412695 AACAGTAAAAAGAAAATAGGCGG + Intronic
1163596298 19:18222998-18223020 CAGAAAAAAAAGAAATGGGGAGG - Intronic
1163800004 19:19358927-19358949 CAGAGGAAAATGATCAGTGGAGG - Intergenic
1163894473 19:20045615-20045637 CTGTGTAAAAAGTAAAGTAGAGG + Intergenic
1163914895 19:20232500-20232522 CATAGAACAAAGAAAAGTGATGG + Intergenic
1163946286 19:20538079-20538101 CAGTGTAAAAAGTGAAGTAGAGG + Intronic
1164302431 19:23973561-23973583 AAGAGTAAAAAGAAGAGGAGAGG + Intergenic
1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG + Intronic
1164658446 19:29941632-29941654 AAAAAAAAAAAGAAAAGTGGGGG + Intronic
1165366347 19:35369141-35369163 CAGTGAAAAAAGAAAACTGTAGG + Intergenic
1165912624 19:39238308-39238330 CAGAGTATAAAGAAAAGGACAGG + Intergenic
1166110256 19:40617953-40617975 CAGAGTTAAAAGTAAATTGCAGG + Intronic
1167326005 19:48826138-48826160 AAGAGAAACAAGAAATGTGGTGG + Intronic
1167562311 19:50233166-50233188 CAAAAGAAAAAAAAAAGTGGGGG - Intronic
1168259819 19:55187042-55187064 CAAAGAAAAAAAAAAGGTGGGGG + Intronic
1168268108 19:55233941-55233963 CACAGAAAAAAGAAAATGGGAGG - Intronic
1168673466 19:58258856-58258878 CAGAGTGACAAGCAGAGTGGAGG + Intronic
925603702 2:5636126-5636148 CAAAAAAAAAAAAAAAGTGGGGG + Intergenic
926380529 2:12283504-12283526 CAAAATAAAAACAAAATTGGAGG + Intergenic
926677127 2:15635022-15635044 CAGATTAAAAAAAAAAATGTTGG + Intergenic
926969782 2:18454931-18454953 CAAAGTAAACTGAAAAGTAGAGG - Intergenic
926999083 2:18773473-18773495 CTGAATAAAGAGAAAAGTGAGGG - Intergenic
927003577 2:18824777-18824799 CTGAGTAAATAGAAAAAGGGAGG + Intergenic
927098685 2:19769436-19769458 CAAAATAAAAAAAAAAGTTGTGG + Intergenic
928674223 2:33634820-33634842 AAAAGAAAAAAGAAAAGAGGTGG - Intergenic
929574909 2:43045373-43045395 CAAAGGAAAAAGAAAGTTGGGGG - Intergenic
930424475 2:51194891-51194913 CAGAGATGGAAGAAAAGTGGGGG - Intergenic
931203706 2:60126298-60126320 GGGAGAAAAAAGGAAAGTGGAGG + Intergenic
933161187 2:79026670-79026692 GAGAGTAAAATGAAGAGTAGGGG - Intronic
933276229 2:80287200-80287222 CTGAGTAGAAAGAAAAGGAGAGG + Intronic
933367013 2:81365656-81365678 TAGAGTAAAAAAGAAAGAGGTGG + Intergenic
935084800 2:99834746-99834768 GAGAGTGACAAGAAAAGTGAAGG - Intronic
935199113 2:100840598-100840620 AAGATTAAAAAAAAAAATGGGGG - Intronic
936563290 2:113560769-113560791 CAGAGGAAAAAGAAAATGCGAGG + Intergenic
936734939 2:115428929-115428951 CACTGTAAAAAGTAAAGTAGAGG - Intronic
937579268 2:123463606-123463628 CAGTGTAAAAATAAATGTAGTGG - Intergenic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937735157 2:125279137-125279159 GGGATTAAAAAAAAAAGTGGAGG - Intergenic
938325760 2:130399264-130399286 CAGAGTAAAAAGATAATTCATGG + Intergenic
938640651 2:133275078-133275100 AAAAGTGAAAAAAAAAGTGGGGG + Intronic
939136854 2:138306578-138306600 AACAGTAAAAAGATCAGTGGTGG - Intergenic
939566232 2:143789372-143789394 CAAAAAAAAAAGAACAGTGGGGG + Intergenic
940016108 2:149106835-149106857 GAGAGTAAAAAAAAGAGGGGAGG - Intronic
940138300 2:150463945-150463967 CAGAGTGATAAGAAATGTTGGGG - Intergenic
940179630 2:150917991-150918013 AAAGGTAAAAAAAAAAGTGGGGG + Intergenic
940474543 2:154145935-154145957 CAAATTAAAAAGAAAAGATGTGG - Intronic
940927497 2:159381363-159381385 CAGAGTAAGTAGATAATTGGGGG - Intronic
940988414 2:160072923-160072945 CAGAGTACAGAGCAGAGTGGAGG + Intergenic
941137813 2:161739232-161739254 CAGATTAACCAGAAAAATGGAGG + Intronic
941471053 2:165887427-165887449 GAGAGTAAGAAAAAAGGTGGAGG + Intronic
941836691 2:170029681-170029703 CAGATTAAATAGTCAAGTGGAGG + Intronic
942058345 2:172205809-172205831 CAGGGGAAACAGAGAAGTGGAGG + Intergenic
942135965 2:172925915-172925937 AAGAGTAAAAAAGAAAGAGGAGG + Intronic
942391393 2:175497399-175497421 CTGAGAAAAAAGAAAATTGGAGG - Intergenic
943031841 2:182694808-182694830 TAGAGGAAAAAAAAAGGTGGGGG + Intergenic
943414682 2:187586959-187586981 GAGAGTAAAAACAAATGTGTTGG - Intergenic
943487162 2:188500496-188500518 GAGAGTAAAAAGAAAATTGTAGG + Intronic
943600105 2:189907236-189907258 CAGAGAGAAAATAAAAGTTGGGG - Intronic
943676032 2:190717270-190717292 CAGAGCAACAAGAAAAATGCCGG - Intergenic
945034131 2:205689708-205689730 GAGATTAAAAAGAAAATAGGAGG - Intronic
945070661 2:205985975-205985997 CAGAGTAAGAACAAAAGAGAAGG + Intergenic
945087283 2:206145180-206145202 CAGGGCAAAAAAAAAGGTGGGGG - Intronic
945105658 2:206311039-206311061 CAAAGTAAAAAGAAAATTCATGG + Exonic
945924768 2:215791919-215791941 GAAAGAAAAAAGAAAAGTGCTGG - Intergenic
945929300 2:215839413-215839435 CAGGGTAAAAAGACAGGTGGAGG + Intergenic
945954968 2:216078136-216078158 CTGACTAGAAAGAAAACTGGAGG + Intronic
945986587 2:216359353-216359375 CAGAGAAAAGAGAAAAGAAGAGG - Intronic
946294351 2:218771970-218771992 CAGAGTAAAAAGAAACGAATAGG - Intergenic
946345825 2:219109648-219109670 CAGAGAATAAAGGAAAGGGGAGG + Intronic
946931181 2:224673061-224673083 CATAGAAAAAAGTAAAGTGGTGG + Intergenic
947265702 2:228277632-228277654 TAAAGTAAAAAGAAAACTTGAGG + Intergenic
947269399 2:228317203-228317225 CACAGTAAAAAGAGGAATGGAGG - Intergenic
947276584 2:228398307-228398329 CAGTGAAAAAAGAAAACTGCAGG - Intergenic
947457593 2:230269741-230269763 CAGAGGAAAAAGTAAAGAAGGGG + Intronic
947628657 2:231637446-231637468 GAGAATAGAAAGAAAAGTTGAGG + Intergenic
947776426 2:232714700-232714722 CACAGAAAACAGAACAGTGGTGG - Intronic
947846802 2:233251366-233251388 GCGATTAAAAATAAAAGTGGGGG + Intronic
947848062 2:233261601-233261623 CAGAATAAAATAAAAAGAGGGGG - Intronic
947870520 2:233435102-233435124 CAGAGTGAAAAGGGAAGTGGTGG + Intronic
948188932 2:236043721-236043743 AAGGGAAAAAAAAAAAGTGGGGG + Intronic
948426540 2:237890768-237890790 CACAGCAAAAACAAAAGTGGAGG - Intronic
1168883687 20:1227296-1227318 CAGACTAAAAAGGAAAGTAGTGG + Intronic
1169228251 20:3869593-3869615 AAAAGGAAAAAAAAAAGTGGTGG - Exonic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1169751541 20:8999563-8999585 CAAAGTAAAAAGCAATCTGGAGG + Intergenic
1169993892 20:11535072-11535094 CAGAGTCAAGAGACAAGGGGAGG - Intergenic
1170010764 20:11720568-11720590 CAAAGTAGAAAGAAAACTGCTGG + Intergenic
1170160965 20:13310619-13310641 CAGAGTAAAGAGAAAAATTATGG + Intergenic
1170274517 20:14569566-14569588 AAGAGAAAAAAAAAAGGTGGGGG - Intronic
1170943494 20:20868708-20868730 CAGACTAAAAATAAAAAAGGAGG + Intergenic
1171036818 20:21719341-21719363 AAGAAGAAAAAGAAAAGTGAAGG - Intergenic
1171565115 20:26176017-26176039 TATAGTAAAAAGAAAAATGGTGG + Intergenic
1172323466 20:34016153-34016175 CTGGGTATAAAGAAATGTGGAGG - Intronic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172532490 20:35642563-35642585 AAAAGGAAAAAGAAGAGTGGTGG - Intronic
1173159229 20:40639929-40639951 CAGAGTAGAAAGGGAAGTAGGGG + Intergenic
1173381966 20:42553484-42553506 CAGAGAAAAAGAAAAAGTGTTGG - Intronic
1173500877 20:43552230-43552252 CAGAATAAAAAGAAAAAGAGAGG + Intronic
1174060476 20:47829377-47829399 AAAAGTAAAAACAAAACTGGAGG + Intergenic
1174071422 20:47901993-47902015 AAAAGTAAAAACAAAACTGGAGG - Intergenic
1174152631 20:48496668-48496690 AAAAGTAAAAACAAAACTGGAGG + Intergenic
1174202199 20:48814553-48814575 AAGAATAGAAAGAAATGTGGTGG + Intronic
1174405393 20:50299562-50299584 CAGGTTAAAAAAAAAAATGGAGG + Intergenic
1174746769 20:53071566-53071588 CATAGTAAATAGAAAAGAAGAGG - Intronic
1175009775 20:55723553-55723575 CAGGGCAAAAAGAAAAATTGTGG + Intergenic
1175511574 20:59531295-59531317 TAAAGTAAAAAGATCAGTGGAGG + Intergenic
1175869694 20:62202752-62202774 CAAAAAAAAAAAAAAAGTGGAGG + Exonic
1176334224 21:5580618-5580640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176393533 21:6240334-6240356 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176404414 21:6349110-6349132 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176432743 21:6639994-6640016 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176467886 21:7075840-7075862 CAGAATAAAAAGAAGAGGGTTGG + Intronic
1176491447 21:7457618-7457640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176509195 21:7680765-7680787 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176511896 21:7755097-7755119 CAGAGAAAAAAGATAACTGAAGG + Intronic
1177819179 21:26012419-26012441 AAGAGTAAAAAGTCAAGGGGAGG - Intronic
1178253603 21:31029862-31029884 CAAAAAAAAAAAAAAAGTGGTGG + Intergenic
1178646009 21:34385623-34385645 CAGAGAAAAAAGATAACTGAAGG + Exonic
1179317601 21:40258472-40258494 CTGTGTAAAAAGTAAAGTAGAGG + Intronic
1180681442 22:17629649-17629671 CACAGTAAAAAGAAAAAAGTGGG - Intronic
1181785349 22:25222573-25222595 CACAGAAAAATGAAAAATGGGGG + Intronic
1181820789 22:25473902-25473924 CAGAGGAGGAAGAAAAGAGGAGG + Intergenic
1182888569 22:33797197-33797219 CAGAGGAAAAAGACAAGAAGGGG + Intronic
1184269143 22:43368470-43368492 CTGAGGAAAAACAAAAGTAGTGG - Intergenic
1185345920 22:50310642-50310664 CAGAAGAAAAAGAAAAGTCCCGG + Exonic
949338083 3:2998643-2998665 CAGATTAAAAAAAAAAGTCAAGG + Intronic
950279101 3:11690951-11690973 AAGAGTATAAAGAAAAGATGTGG + Intronic
951074077 3:18368030-18368052 CAAAGAAATAAGAAAAGTGGAGG - Intronic
951194562 3:19809393-19809415 CAGAGTTAAAAAAAAAAAGGTGG + Intergenic
951331339 3:21372461-21372483 GAGGAGAAAAAGAAAAGTGGAGG - Intergenic
951449952 3:22826078-22826100 CAGAGTAGAATGGAAATTGGTGG + Intergenic
951479587 3:23145452-23145474 CAGGGTAAAAATAAATGTGCAGG - Intergenic
951715475 3:25639604-25639626 CTGATTAAAAACAAATGTGGAGG - Intronic
952070683 3:29631803-29631825 CAAATTAAACAGAAAAGGGGAGG + Intronic
952440482 3:33322533-33322555 CTGAGTGAAAAAAAAAGTTGTGG + Intronic
953051778 3:39350795-39350817 CAGAGAAAAAAAAAAAGGAGAGG + Intergenic
953193077 3:40707756-40707778 AAGAGAAAAAAAAAAAGTAGGGG - Intergenic
953253847 3:41270182-41270204 CAGAGTCCAGAGAAAAGAGGTGG + Intronic
953972014 3:47355362-47355384 GAGAGTAAAAAGATAAGGGAAGG + Intergenic
954074064 3:48163943-48163965 CAGGGTGAAAAGAAAAAAGGGGG - Intronic
954730905 3:52660980-52661002 AAGAGAAAAAAGAATAGTAGAGG - Intronic
955876524 3:63495753-63495775 GACAGTAAAAAGATCAGTGGTGG + Intronic
955890004 3:63640082-63640104 CAGAGTTTAAGGAGAAGTGGGGG + Intergenic
956182002 3:66526220-66526242 CAGAGTAAAAAAAAAAATTGGGG - Intergenic
956613712 3:71150423-71150445 CATGGTAAAAAGAGAAGTGGCGG - Intronic
956679740 3:71767516-71767538 CAGAAAAAAAAAAAAAGTAGTGG - Intergenic
956771103 3:72526633-72526655 GAAAGAAAAAAGAAAAGTGTAGG - Intergenic
957060799 3:75479785-75479807 GAAAGTAAAATGGAAAGTGGGGG + Intergenic
957324349 3:78673323-78673345 CAGTATAAAAATAATAGTGGTGG + Intronic
957809461 3:85200708-85200730 CAGAGTACAAATAAAAATGTTGG + Intronic
957833498 3:85553930-85553952 CTGAGTGAAAAGAAAAGTTATGG + Intronic
958117167 3:89234980-89235002 AAGAGAAAAAAGAAAGGAGGAGG - Intronic
959266540 3:104147351-104147373 CTGAGTAAAAAGAAAAGGCTTGG + Intergenic
959388204 3:105739732-105739754 CAGAGAGAAAAGAAAAGGGGTGG + Intronic
959550278 3:107647890-107647912 AAGAGGAAAGAGAAAAGTGATGG + Intronic
959556074 3:107719950-107719972 CAGAGTACAAAGAGGAGGGGAGG + Intronic
959601597 3:108192471-108192493 CTGAGAAAAAAGAAAAGAGTAGG - Intronic
959719066 3:109467218-109467240 CACAGTAAACATAAAAGTGCAGG - Intergenic
959745672 3:109774438-109774460 TAGAGAAAAAATAAAAGTTGAGG + Intergenic
959763110 3:109992351-109992373 GAGAGAAAAAATAAAATTGGAGG - Intergenic
959800173 3:110484545-110484567 AAAAGAAAAAAGAAATGTGGTGG + Intergenic
959990585 3:112627129-112627151 CAGAATGAAAAAAGAAGTGGGGG - Intronic
959992411 3:112643963-112643985 AAGAATAAAAAGAAAAGGAGGGG + Intronic
960538756 3:118842375-118842397 GACAGAAAAAAGAAAAGGGGAGG + Intergenic
960566426 3:119137272-119137294 CTAAGCAAAAAGAAAAGTGGAGG + Intronic
960662466 3:120075925-120075947 CTGAGGAAAAAAAAAAGTTGGGG + Intronic
960927244 3:122806975-122806997 CATAATAAAATGAAAAATGGGGG - Intronic
961032394 3:123618039-123618061 CAGAGCAAAGGGAAAAGTTGTGG - Intronic
961521714 3:127470912-127470934 CAGACCAAGAAGGAAAGTGGGGG + Intergenic
962346210 3:134620639-134620661 CAGAGTGACATGAAAGGTGGGGG - Intronic
962621977 3:137189541-137189563 AAAACAAAAAAGAAAAGTGGGGG - Intergenic
962656923 3:137556402-137556424 CAGTGAAAAAAGAAAACTGCAGG + Intergenic
962948176 3:140192562-140192584 CAGAGTAAAAAAAAAATTACTGG - Intronic
963025559 3:140915473-140915495 CAGGGAAGAAAGAAAAGTGAAGG - Intergenic
963475144 3:145794719-145794741 CAGTGTAAAAAGAAAATATGGGG - Intergenic
963550671 3:146718065-146718087 AAGAGTAAAATGTAAAATGGTGG - Intergenic
963755294 3:149228601-149228623 CAGAACAAAAAAAAAAGGGGGGG - Intergenic
963783363 3:149509280-149509302 CAGAGTTAAAAGAAAAGAAAAGG + Intergenic
963991690 3:151663806-151663828 CAGAGGACTAAGAATAGTGGAGG + Intergenic
964028356 3:152105434-152105456 GAGAGTAACAAGAAAAGTCTGGG - Intergenic
964585016 3:158288213-158288235 CTGAGTACATAGAAAAGAGGAGG - Intronic
965005830 3:163021238-163021260 CAGAGAAGAAGAAAAAGTGGAGG - Intergenic
965107978 3:164382940-164382962 TGGAGTAAAAAGAAAAATGGGGG + Intergenic
965339472 3:167469438-167469460 CACTGTAAAAAGAAAAGTTGAGG - Intronic
965725321 3:171710054-171710076 AAAAGAAAAAAGAAAAGTTGGGG - Intronic
965959139 3:174407931-174407953 GAGAGTAAAGAGAAAAGTAAAGG - Intergenic
966703384 3:182882053-182882075 CAGAGCAAAATGAAAAGTGTGGG + Intronic
968527155 4:1066327-1066349 CTCAGAAAAAAGAAAAGCGGAGG - Intronic
969855726 4:9997693-9997715 CTGTCTCAAAAGAAAAGTGGGGG + Intronic
970489190 4:16554728-16554750 GACAGTAAAAAGATCAGTGGTGG + Intronic
970867418 4:20774999-20775021 TAGAGTAAACAGAAAAGAGAGGG - Intronic
970906944 4:21226862-21226884 CAGAGTAAAAAAAAAATTACTGG - Intronic
971688526 4:29802845-29802867 AAGAGTAAATTGAAAAGTTGGGG + Intergenic
971805499 4:31353261-31353283 TAGAGTTAATAGAAAAGGGGAGG + Intergenic
971986023 4:33825538-33825560 TATACTAAAAAGAAAAATGGTGG - Intergenic
972198527 4:36683508-36683530 CTGAGTGAAAAGAAAAGTCATGG - Intergenic
972337881 4:38124081-38124103 CAGAGTAGAAATATAATTGGAGG - Intronic
972386532 4:38572060-38572082 CTCAGGAAAAAAAAAAGTGGGGG + Intergenic
972886567 4:43498559-43498581 TAAAGTAAAAAGATCAGTGGTGG - Intergenic
973636521 4:52866203-52866225 AAGAGAAAAAAGAAAAAAGGGGG - Exonic
974363240 4:60911079-60911101 CAGAGTTAACAGAAAACTTGGGG + Intergenic
974671749 4:65039105-65039127 CAAAATAAAAAGATAAGTGATGG - Intergenic
975007607 4:69310269-69310291 CACTGTAAATAGAAAAGTAGAGG + Intronic
975096209 4:70460400-70460422 AAGAGCAAAAAGAAAGGTGATGG + Intronic
975153280 4:71044205-71044227 CAGAGAAGGAAGAAAAGTGGGGG + Intergenic
975780238 4:77831470-77831492 AAAAGAAAAAAAAAAAGTGGGGG + Intergenic
975840907 4:78472908-78472930 GAGAGTAAAAAGAAAATTCATGG - Intronic
975899539 4:79135556-79135578 AAGAAAAAAAAGAAAAGAGGAGG - Intergenic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976398349 4:84582110-84582132 AAGAGAAAAAAGAAAAAAGGCGG - Intergenic
976533985 4:86190197-86190219 CAGCGTAAAAAGAAAATTTCAGG - Intronic
976710062 4:88060656-88060678 CAAAGTAAAAAAAAAGTTGGTGG + Intronic
976944463 4:90747480-90747502 CAGAGAAAAAAAAAGAGAGGTGG + Intronic
976951806 4:90842397-90842419 GAGAGTAAATAGGAAAGTAGTGG + Intronic
977027750 4:91841963-91841985 CAGAGTAAACAGACAACTGACGG + Intergenic
977059605 4:92240709-92240731 AAAAGTAAATAGAAAAGTGCAGG + Intergenic
977109104 4:92928265-92928287 CAGAGTAAAAAGTAGAGGGCTGG + Intronic
977377858 4:96230301-96230323 CAGAGAAGGAAGAAAAATGGTGG + Intergenic
977783216 4:101003814-101003836 CAAAGAAAAATGAAGAGTGGAGG - Intergenic
978325116 4:107544890-107544912 CAGATGAAAAAGAAAAATGTTGG - Intergenic
978623049 4:110653731-110653753 AAGAGTGAAAAGAAAAGTACAGG + Intergenic
979002679 4:115244878-115244900 GAGAATAAAAAAAAAAGTGGTGG + Intergenic
979102087 4:116630742-116630764 CAGATTGCAAAGAAAAGAGGAGG - Intergenic
979292549 4:118993751-118993773 CAAAGTAAAAAGTAATTTGGGGG - Intronic
979542880 4:121906355-121906377 TAGAGTTAAAAGGAAAATGGGGG + Intronic
979833531 4:125331069-125331091 AAGAGAAAAACGAAAACTGGAGG - Intronic
980445003 4:132893843-132893865 CAGAGGAAAAAGAGAACTGGAGG + Intergenic
980650853 4:135713034-135713056 CAGTATAAAAAATAAAGTGGAGG + Intergenic
980681128 4:136162151-136162173 CAGAGTAAAAAGGAAATTAATGG - Intergenic
980762001 4:137246892-137246914 CATAGTAAGAAGAGAAATGGAGG - Intergenic
980782250 4:137506052-137506074 CTGAGTAAAACAAAAAGTAGAGG - Intergenic
981042627 4:140237544-140237566 CAGCTTAAAAAGAAAAGTCAGGG + Intergenic
981173295 4:141650072-141650094 CAGTATAAAAGCAAAAGTGGTGG + Intronic
981177277 4:141696369-141696391 CAGAGCAAAAAGAATATTGTAGG - Intronic
981234674 4:142401226-142401248 CAGAGGAGAGAGAGAAGTGGAGG - Intronic
981603712 4:146521202-146521224 CACATTAAAAAAAAAAGTGGAGG - Intronic
981691840 4:147517447-147517469 GAGAGGAAAAGGAAAAGAGGGGG + Intronic
982405707 4:155017678-155017700 CAGAGCAAAAAGGAAAGTGAAGG + Intergenic
982536441 4:156612645-156612667 AAGAGTAAAAGGTAAAGTTGAGG - Intergenic
982536616 4:156615068-156615090 CAGACTAAACTGAAATGTGGTGG + Intergenic
982765424 4:159342225-159342247 CAAACTTAAAAAAAAAGTGGGGG - Intronic
983291864 4:165817345-165817367 CAGACTAAAAAAAAAAGTACGGG + Intergenic
983433914 4:167687259-167687281 CAAAGTAAAAATAAAATTGTTGG + Intergenic
983781076 4:171670577-171670599 CAGAGTTAAAAGAATAGTAAAGG - Intergenic
984003149 4:174275344-174275366 CTGAGTAAAAATAAAACTAGGGG + Intronic
984230068 4:177085192-177085214 CAGACAAAAATGAAAAGGGGAGG + Intergenic
984236971 4:177171324-177171346 AAAAGGAAAAAAAAAAGTGGGGG + Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984940020 4:184922724-184922746 CATCGTAAAAAGTAAAGTAGAGG + Intergenic
985298561 4:188461501-188461523 CTTAATAAAAAGCAAAGTGGAGG + Intergenic
985436554 4:189936008-189936030 GATAGCAAAAAGAAAAATGGAGG - Intergenic
985502030 5:254355-254377 TAGAGTAATAAGAAACGTGATGG + Intronic
985734987 5:1574311-1574333 TAGAGTAATAAGAAACGTGATGG - Intergenic
986276732 5:6281715-6281737 CGGAGTAAAGGGAGAAGTGGGGG + Intergenic
987057979 5:14213223-14213245 AAGAGTGAAAAGAAAAGAGGAGG - Intronic
987269209 5:16287917-16287939 GAGACTAAAAAGGAAAGTGGAGG + Intergenic
987458888 5:18182491-18182513 CAGAGTACAAGGAAAAGAGGTGG + Intergenic
987719950 5:21620171-21620193 GACAGGAAAAAAAAAAGTGGGGG + Intergenic
988023070 5:25649238-25649260 CAGAGTATGAAGAGAAGTGGAGG + Intergenic
988457682 5:31401486-31401508 AAGAGTTAAAAGAAATGAGGTGG - Exonic
988677153 5:33443793-33443815 CTGGGTAAAAAGAAAAATTGCGG - Intronic
989547246 5:42688864-42688886 CAGAATAAAAAGAAAAGGCAAGG - Intronic
990004397 5:50928989-50929011 CAGAGTAAAAAAAATTGTGATGG + Intergenic
990240235 5:53809852-53809874 CTGAGTGAAAAGAAAGTTGGAGG - Intergenic
990562776 5:56999926-56999948 CCCATTAAAAAAAAAAGTGGGGG + Intergenic
991138812 5:63214992-63215014 TACAGTAAAAAAAAAAATGGGGG + Intergenic
991181614 5:63757863-63757885 CATTGTAAAAAGTAAAGTAGAGG + Intergenic
992040020 5:72821331-72821353 CTTAGTAAAAACAAAAGTGGTGG - Intronic
992130489 5:73686859-73686881 AAGAGTAAAATGAAAAGTACAGG + Intronic
992657642 5:78926438-78926460 TAAAGAAAAAAAAAAAGTGGGGG - Intronic
992903771 5:81325056-81325078 CAGAGAAAAAAGAGAACTGATGG + Intergenic
992939433 5:81749661-81749683 CAGTTTAAAAAAAAAAGGGGGGG + Intronic
993950025 5:94163406-94163428 CATACTAAAGAAAAAAGTGGTGG - Intronic
994365237 5:98908241-98908263 CATAATAAAAAGAAAAGAGAAGG - Intronic
994669294 5:102747280-102747302 AAGAGCAAAAAGAAAGGTGTGGG - Intergenic
995319465 5:110816303-110816325 CAAAAAAAAAAAAAAAGTGGGGG + Intergenic
995609087 5:113889841-113889863 AAGAGGAAAAAGACAACTGGGGG - Intergenic
996073095 5:119157265-119157287 CAGAGTGAAGAGAAAAGCCGTGG - Intronic
996316291 5:122164414-122164436 CAGAGTATAAAGCCAAGAGGAGG + Intronic
996353719 5:122574083-122574105 CAGAGCAAGAAGAAAAAAGGGGG + Intergenic
996529153 5:124509668-124509690 CAGAGTACAAAGAAGACAGGTGG + Intergenic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
997408556 5:133672035-133672057 TAGTGTAAAAAGTAAAGTAGAGG - Intergenic
997448312 5:133959864-133959886 ACGAGTACCAAGAAAAGTGGAGG - Exonic
997592310 5:135082546-135082568 AACAGTAAAAAGAAAATTAGAGG - Intronic
997610580 5:135213032-135213054 CAAAAAAAAAAAAAAAGTGGGGG - Intronic
997994429 5:138574553-138574575 GAAAGAAAAAAGAAAAGTAGTGG + Intronic
998140883 5:139698769-139698791 CACAGGAGAGAGAAAAGTGGAGG + Intergenic
998227206 5:140336238-140336260 CAGAGGAAATGGAAAAGGGGAGG - Intronic
999416501 5:151401466-151401488 CTGAGCAAAAAGAAAAAAGGTGG - Intergenic
999512453 5:152266903-152266925 CAGACTAAGAAGAGAACTGGTGG - Intergenic
999954672 5:156687433-156687455 CAGAACAAAAAGAAAAGGGGAGG + Intronic
1000182375 5:158823932-158823954 CAAATTAAAAAAAAAACTGGTGG + Intronic
1000760009 5:165211204-165211226 CAGAGTAAAACCAAAGGTGATGG - Intergenic
1001080270 5:168662451-168662473 CAGAGGGAAAAAAAAGGTGGGGG - Intronic
1001389305 5:171366018-171366040 CAAACAAAAAAGAAAAGTGACGG + Intergenic
1001501591 5:172240629-172240651 TATAGTTAAAAAAAAAGTGGGGG - Intronic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1001856972 5:175021334-175021356 AAGAGTAACAAGACAAGTAGGGG - Intergenic
1001970055 5:175948346-175948368 AAGAGTAAATGGAAAATTGGAGG - Intronic
1002080065 5:176732478-176732500 CAGAGGAAAATGCCAAGTGGGGG + Intergenic
1002247382 5:177895418-177895440 AAGAGTAAATGGAAAATTGGAGG + Intergenic
1003068896 6:2928650-2928672 CAGACTTCAAAGAACAGTGGGGG + Intergenic
1003123210 6:3335016-3335038 TACAATAAAAAGAAAAGTTGAGG + Intronic
1003556958 6:7148525-7148547 CAGTGGCAAAAGTAAAGTGGGGG + Intronic
1003572594 6:7265706-7265728 CAGAGAAACAAGAAAAGTTATGG + Intergenic
1004242426 6:13936909-13936931 GAGAGTAAAAAGAATTGGGGAGG + Intronic
1004630457 6:17416196-17416218 CAGAGGAAAATGAAATGTTGGGG + Intronic
1005006178 6:21289660-21289682 CAAACAAATAAGAAAAGTGGAGG - Intergenic
1005092413 6:22071561-22071583 AAGTTTAAAAAGAAAAGAGGGGG + Intergenic
1005101301 6:22174834-22174856 TATAATAAAAAAAAAAGTGGGGG - Intergenic
1005370326 6:25125218-25125240 CAGAAAAAAAAGCAAAGTGGAGG + Intergenic
1005388784 6:25312405-25312427 CAGAAGAAAAAAAAAATTGGTGG - Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005440251 6:25859868-25859890 CAGGGTAAAAAGTAAGGGGGAGG - Intronic
1005534784 6:26744415-26744437 CAGAGAAAGAAGGAGAGTGGTGG + Intergenic
1005817930 6:29571962-29571984 CAGAGTAAAAAGAATATAGGAGG + Intronic
1006241345 6:32682007-32682029 CAAAGAGAAAAGAAGAGTGGGGG + Intergenic
1006246825 6:32744422-32744444 CAGAGGAAAAAAAAAAGTGGGGG + Intronic
1006524213 6:34589931-34589953 AAGATTAAAGAGAAAAGAGGAGG + Exonic
1006780138 6:36627021-36627043 CAAAGAAAAAAGAAATGTGAAGG - Intergenic
1007017878 6:38487696-38487718 AAAAGAAAAAAGAAAGGTGGAGG + Intronic
1007436646 6:41817610-41817632 AAAAGAAAAAAGAAAAATGGTGG - Intronic
1007802828 6:44412302-44412324 CTGAAAAAAAAAAAAAGTGGGGG - Intronic
1007866385 6:44974428-44974450 CAGAGGAGAAAGAATATTGGAGG - Intronic
1007900991 6:45412670-45412692 CAGAGTAAAAAAAAAAAAGTAGG - Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008326747 6:50191595-50191617 CAGGGTAACCAGAAAAGTAGAGG - Intergenic
1008454982 6:51699266-51699288 GACAGTAAAAAGACCAGTGGTGG - Intronic
1009218045 6:60946168-60946190 CAGAATCACAAGAAAAGTAGAGG - Intergenic
1009350544 6:62671581-62671603 CTGAATAGAAAAAAAAGTGGAGG - Intergenic
1009559676 6:65222828-65222850 CACAGTAAGAAGAAACATGGTGG + Intronic
1010016373 6:71108965-71108987 CAGTGTAAAATGAAAACTGTGGG + Intergenic
1010548840 6:77194178-77194200 CAGAGGAAAAAGAAAACCAGAGG + Intergenic
1010687031 6:78865420-78865442 CAAAATAAAAACAAAGGTGGGGG - Intergenic
1012125484 6:95423208-95423230 TAGAGGAAAGAGAAAAGTTGGGG - Intergenic
1012215897 6:96583350-96583372 CAGACTAATAATAAATGTGGAGG + Intronic
1012423906 6:99093890-99093912 CAGAATCAAAAGAGAAGAGGGGG + Intergenic
1012532560 6:100255607-100255629 CAGATTTAAAAGAATAATGGAGG + Intergenic
1012669404 6:102022981-102023003 CAGATTGAAAAGGACAGTGGTGG + Intronic
1012798895 6:103800358-103800380 CAGAGTAAAAACAAAAAGGGAGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013169190 6:107620769-107620791 CACAGAAAAAAGAAATATGGTGG - Intronic
1013834335 6:114315297-114315319 CGGAATAAAAAGAAATGTGATGG - Intronic
1014638060 6:123873363-123873385 CAGGGCAAAAAGAAAAGATGAGG + Intronic
1014749310 6:125237094-125237116 CAGAGTAAGAAGAAATGAGAGGG + Intronic
1014776911 6:125521629-125521651 AAAAGAAAAAAGAAAAGTCGTGG - Intergenic
1015112444 6:129609000-129609022 AAGAGGAAAAAAAAAAGAGGAGG + Intronic
1015582393 6:134740029-134740051 CAGAATGAAAAGAAAAGCAGTGG - Intergenic
1016144637 6:140654345-140654367 TATAGTAAAAAGAAAAGTTTTGG + Intergenic
1016173191 6:141045145-141045167 CAGATTAACAAGAAAAGAGAAGG - Intergenic
1017092186 6:150769820-150769842 ATGAGAAAAAGGAAAAGTGGAGG - Intronic
1017637564 6:156457209-156457231 CAGAGTCAAAAAACAAGTGCAGG - Intergenic
1018101044 6:160440689-160440711 AAGAGTGAAAAGAAAACTGTAGG - Intronic
1018174354 6:161166174-161166196 AGGAGCAAAAAGACAAGTGGTGG + Intronic
1018546728 6:164945407-164945429 CAGAGTAAGAAGTAAGGTGAAGG + Intergenic
1018556683 6:165058012-165058034 AAGGGTAAAAACAAAAGAGGAGG - Intergenic
1018581796 6:165314287-165314309 AAGAGAAAAAAGCAAGGTGGAGG - Intergenic
1019847884 7:3524803-3524825 CAGATTAGAAAAAAAATTGGAGG + Intronic
1019891190 7:3948560-3948582 CAGCCTTAAAAGAACAGTGGTGG - Intronic
1020835522 7:13145590-13145612 CAGGTTAAAAAAAAAGGTGGGGG - Intergenic
1020950462 7:14669546-14669568 CAGAGAAAGAAGAAATGTTGGGG - Intronic
1020991706 7:15205109-15205131 CAAATTACAAAGAAATGTGGTGG + Intronic
1021521965 7:21547787-21547809 GAAAGTAAATAGAAAAGAGGAGG - Intronic
1022032910 7:26508383-26508405 CAGAGTAAAGAGAAATGTCTGGG - Intergenic
1022576229 7:31499740-31499762 AAGGGTAAGAAGAAAAGTTGAGG - Intergenic
1022618797 7:31960485-31960507 CTGTGTATAAAGACAAGTGGTGG + Intronic
1023152063 7:37211530-37211552 GGGAGTAAAAAGAAAAGGGAGGG + Intronic
1024259924 7:47566466-47566488 CAGAGTAAAAGGGAGAGTAGAGG - Intronic
1024440342 7:49408893-49408915 CAGAGCAAAAAAAAAAAGGGGGG + Intergenic
1024761084 7:52597267-52597289 CAGACTCAAAAGAACACTGGGGG + Intergenic
1024937194 7:54722431-54722453 CAGGGTAAGAAGGAGAGTGGAGG - Intergenic
1025169158 7:56740723-56740745 CAAAAAAAAAAAAAAAGTGGTGG - Intergenic
1025214284 7:57042849-57042871 GAGAGAAAAAAGAAAAGAGAAGG - Intergenic
1025272341 7:57535702-57535724 TATACTAAAAAGAAAAATGGTGG - Intergenic
1025286487 7:57666611-57666633 CTGTGAAAAAAGAAAAATGGTGG - Intergenic
1025628877 7:63249643-63249665 CACAGTAAAATGTAAAATGGTGG + Intergenic
1025653386 7:63494451-63494473 CACAGTAAAATGTAAAATGGTGG - Intergenic
1025657669 7:63533964-63533986 GAGAGAAAAAAGAAAAGAGAAGG + Intergenic
1025843377 7:65173053-65173075 GAGAGAAAAAAGAAAAGAAGAGG - Intergenic
1025879668 7:65522916-65522938 GAGAGAAAAAAGAAAAGAAGAGG + Intergenic
1025893769 7:65679674-65679696 GAGAGAAAAAAGAAAAGAAGAGG - Intergenic
1026051817 7:66953102-66953124 CAGCTTAAGAAGAAAAGTTGTGG + Intronic
1026288160 7:68981940-68981962 AAGTGTAAAAAGTAAAGTAGAGG + Intergenic
1026544063 7:71306412-71306434 CAGAGAAAGAAGAATAGTGGGGG - Intronic
1026544380 7:71309038-71309060 GAGAGTAAAAAGAAATGAGCTGG - Intronic
1026582167 7:71627535-71627557 CAGAGTAGTGAGAACAGTGGAGG + Intronic
1026981880 7:74531719-74531741 AAAAGAAAAAAAAAAAGTGGGGG + Intronic
1027264877 7:76488893-76488915 GAGAAAAAAAAAAAAAGTGGGGG + Intronic
1027316250 7:76986996-76987018 GAGAAAAAAAAAAAAAGTGGGGG + Intergenic
1028210328 7:88066646-88066668 GAGTGTCAAAAGAAAAGAGGAGG + Intronic
1028317070 7:89416418-89416440 TAGAGAAAGCAGAAAAGTGGTGG - Intergenic
1028492622 7:91429837-91429859 CAGAATGAAAAGAGAAGTGATGG + Intergenic
1028544735 7:91985646-91985668 CACAGAAAAAAGAAAGGGGGTGG - Intronic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1029897597 7:104000926-104000948 CAGAATAAAAAGTTAAGTTGTGG + Intergenic
1031062468 7:117067448-117067470 CTGAGTACAAGGAAAAGTAGGGG + Intronic
1031184585 7:118460407-118460429 CAGAGGAAAATAAAAATTGGAGG + Intergenic
1031313755 7:120231597-120231619 CAGGGGAAAAATAAAACTGGGGG + Intergenic
1031612947 7:123847824-123847846 CAGAATAAAGAGAAAAAAGGGGG - Intronic
1031711247 7:125048585-125048607 CAAAATAAAAAGAAAAGTGGAGG + Intergenic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1032853995 7:135818927-135818949 CAGAGGAAAAAGAAGAGGAGAGG - Intergenic
1033564958 7:142569581-142569603 CAGAGAACAAAGAAAAGCAGGGG + Intergenic
1033882876 7:145908314-145908336 CAGAAAAAAAAAAAAAATGGTGG + Intergenic
1034000412 7:147406182-147406204 CAGAGAAAAAAGAAAAGGAAAGG + Intronic
1034525254 7:151655594-151655616 CAGAGCAAAAAGAAAATGAGAGG + Intronic
1034665537 7:152814808-152814830 CAAAATAAAAAGAAAAGTCATGG - Intronic
1034735956 7:153429833-153429855 CAGAGCAAAAATAAAATTTGAGG + Intergenic
1035015855 7:155765439-155765461 CAGAGTACTAAGAAATGTGGAGG + Intronic
1035287725 7:157816867-157816889 CTGAGTAAAGAGAAAAGAGGAGG - Intronic
1035584460 8:761186-761208 CAGAGGAGAAAGTAAAGTGGGGG - Intergenic
1035934238 8:3819085-3819107 CAGAGTAGAGAGAAAAGTGTAGG + Intronic
1036466990 8:9007711-9007733 CTAAGTAAAAAGAAGACTGGTGG - Intronic
1036649636 8:10634108-10634130 CTGAGTAAGAAGAGAAGTGATGG + Intronic
1037130889 8:15406599-15406621 TAGTGTAAAAAGTAAAGTAGAGG - Intergenic
1037375944 8:18228319-18228341 CAGAGAAAAAAGAAAACTACAGG + Intergenic
1037497355 8:19452591-19452613 CAGAGGAAAAAGGAAAGTTTTGG - Intronic
1037549948 8:19960826-19960848 GAGAGGAGAAAAAAAAGTGGGGG + Intronic
1037591195 8:20313416-20313438 GTGGGTAAAAAAAAAAGTGGGGG + Intergenic
1037864406 8:22431719-22431741 CAGAAAATAAAAAAAAGTGGGGG + Intronic
1037936834 8:22920530-22920552 CAGTGTGAGAAGAAAAGTGGCGG + Intronic
1038037753 8:23701025-23701047 CAGCTTAAAAAAAAAAGTAGTGG - Intergenic
1038047810 8:23781069-23781091 CTGAGTAAACAAACAAGTGGAGG - Intergenic
1038268929 8:26059708-26059730 CAGAGAAGAAAGAGAAGTGATGG + Intergenic
1038348526 8:26755190-26755212 CAGAGAAAAAAAAAAAAAGGAGG - Intronic
1039226289 8:35392212-35392234 CTGACTCAAACGAAAAGTGGAGG - Intronic
1039432316 8:37534585-37534607 GAGAGTAACAAGAATGGTGGAGG + Intergenic
1039619664 8:38984962-38984984 CAGAGTTCAAAGAAAAATGTAGG - Intronic
1039705893 8:40007095-40007117 CAGTGAAAAATGAAAGGTGGAGG + Intronic
1040472809 8:47749675-47749697 CAAAAAAAAAAAAAAAGTGGGGG - Intergenic
1040956135 8:52981983-52982005 CTGAGCAAAGAGAAAAATGGAGG - Intergenic
1041170485 8:55137194-55137216 CAAAGTCAAAAGAAAGTTGGAGG + Intronic
1041418401 8:57639843-57639865 CAAAGTAATCAGACAAGTGGAGG - Intergenic
1041472012 8:58221074-58221096 GAGAATAAAAAGAAAAATGATGG - Intergenic
1041572922 8:59358123-59358145 AAGAGTTAGGAGAAAAGTGGTGG - Intergenic
1042036495 8:64539897-64539919 AAGAATAAAAAGAAAAGCAGGGG + Intergenic
1042347493 8:67742398-67742420 CAGAGTGAGAAGTACAGTGGTGG + Intronic
1043303065 8:78759062-78759084 CAGATTAAAAAAAAAGGTGGGGG - Intronic
1043363283 8:79500165-79500187 CAGAGAATGAAGAAAAGCGGGGG - Intergenic
1043392027 8:79801092-79801114 AAGAGTCAAAAGAAAAGTTTGGG - Intergenic
1043513994 8:80979282-80979304 CAGAGTAGAAAACAGAGTGGAGG + Intronic
1044459986 8:92432911-92432933 CATTTTAAACAGAAAAGTGGAGG - Intergenic
1044616798 8:94150890-94150912 CAGAGAAGAAAGAACAGTAGGGG - Intronic
1044837578 8:96311319-96311341 GAGAGTATAAAGAAAAATTGAGG + Intronic
1044855369 8:96469907-96469929 CAGAAAAAATAGAAAGGTGGTGG - Intergenic
1045414993 8:101957267-101957289 GGTAGTAAAAAGAAAAGTTGGGG + Intronic
1045840797 8:106578318-106578340 CAGAATATAAAGAATAATGGAGG - Intronic
1046248983 8:111605101-111605123 CTGAGGAAAGAGAAAAGAGGTGG - Intergenic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046560475 8:115831009-115831031 CAGAGTAAAAAGCCCAGTGGTGG - Intergenic
1047054901 8:121153077-121153099 GAGAGAAGAAAGAAAACTGGAGG - Intergenic
1047520923 8:125594792-125594814 CAGATTAAATAGAAGAGTGCTGG + Intergenic
1047866625 8:129031419-129031441 CAGAGCAAAAAAAAAGGAGGAGG - Intergenic
1047895469 8:129361679-129361701 CAGAGTTAAGAGAAAAATGTTGG + Intergenic
1047909708 8:129514711-129514733 GAAAATAAAAATAAAAGTGGTGG + Intergenic
1047933634 8:129753611-129753633 CAGAGGGAAAAGTAAAGAGGAGG + Intronic
1048030409 8:130626261-130626283 CAGAGGAAACAGCAAAGTGAAGG - Intergenic
1048735167 8:137491227-137491249 CTGATTAAAAAAAAAAGTGGTGG - Intergenic
1048845545 8:138601319-138601341 CAGAGGAGTGAGAAAAGTGGGGG - Intronic
1049080390 8:140438500-140438522 CAGAGGAAAAGGGAAAGTGTGGG + Intronic
1049123657 8:140765474-140765496 TACAGTAAAAAAAAAAGTTGGGG + Intronic
1049819070 8:144623296-144623318 CAGAGTACAAGGAAAGATGGTGG + Intergenic
1049948673 9:623211-623233 TAAAATAAAAAAAAAAGTGGAGG + Intronic
1050001164 9:1078144-1078166 TAGGGAAAAAAGAAAAGTTGAGG - Intergenic
1050690066 9:8217045-8217067 CAGAGTAAAGAGACAAGTCATGG - Intergenic
1050734067 9:8743099-8743121 CAAATTAAAAAAAAAAGGGGGGG + Intronic
1050756157 9:9006317-9006339 AAGAACAAAAAGAAAAGAGGAGG - Intronic
1050845470 9:10211796-10211818 AAGAGTAAGAAGAAGAGAGGGGG + Intronic
1051488329 9:17633078-17633100 CAAAGTGAAAAGCAATGTGGAGG - Intronic
1051502510 9:17793343-17793365 TGCAGTAAAAAGAAAAGTGGTGG - Intronic
1051520322 9:17980321-17980343 CAGAATAAAAAGAGATGTGGTGG - Intergenic
1051577956 9:18638861-18638883 TAGAGCAAAAAGAAAACTGGAGG + Intronic
1051810174 9:21039641-21039663 CATAGAAGACAGAAAAGTGGGGG + Intergenic
1051831050 9:21277162-21277184 GAGAGGAAAAAGAAAAGTAAAGG - Intergenic
1051927151 9:22342611-22342633 TACAGTAAAAAGAAAAATGAAGG + Intergenic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052161597 9:25267677-25267699 AAGAGAAAGAAGAAGAGTGGTGG - Intergenic
1052255560 9:26452361-26452383 CAGAGCAAAAAGAAAAAAGCTGG - Intergenic
1052488565 9:29133263-29133285 TAGAATTAAAAGCAAAGTGGTGG + Intergenic
1052549439 9:29929272-29929294 CAGAGTAAAGACAAAAGTGAAGG + Intergenic
1052981115 9:34450308-34450330 CAAAAAAAAAAAAAAAGTGGGGG + Intronic
1053459467 9:38257460-38257482 CAGAGTAAAAATAAACTTGAAGG - Intergenic
1053569728 9:39291796-39291818 CAGGCTGAAAAGAAAAGTGAAGG + Intergenic
1053898943 9:42773651-42773673 CAGTGGAAAAAGAAAGTTGGAGG - Intergenic
1054127420 9:61327217-61327239 CAGGCTGAAAAGAAAAGTGAAGG - Intergenic
1054876991 9:70107352-70107374 CAGAGGAAAAGGAAAGGAGGAGG + Intronic
1055207531 9:73751050-73751072 CAGAGGAAAAAAAAAATGGGTGG + Intergenic
1055633828 9:78254012-78254034 CAGATCAAAAAGAAAAGTGCCGG - Intronic
1055698894 9:78919398-78919420 TATAGTAAAAAAAAATGTGGAGG - Intergenic
1055955696 9:81771615-81771637 CACAGAAAAAAAAATAGTGGAGG - Intergenic
1055982529 9:82018838-82018860 CCAAGGAAAAAGACAAGTGGTGG - Intergenic
1056073139 9:83009757-83009779 CTGGATAAAATGAAAAGTGGGGG + Intronic
1056171889 9:83994239-83994261 CAGAGTAAAAAGACAATTTATGG - Intronic
1056861736 9:90191149-90191171 AAAAGAAAAAAGAAAAGTGAAGG - Intergenic
1057366674 9:94428596-94428618 CATAGTAAAAAAAAAAAAGGGGG - Intronic
1057432490 9:95006653-95006675 CTGTGGAAAAAGAAAAGGGGTGG - Intronic
1057466980 9:95323270-95323292 CAGAGCAAAAAAAAAAAAGGAGG + Intergenic
1057615079 9:96582144-96582166 CACTGTAAAAAGTAAAGTAGAGG + Intronic
1057767407 9:97934378-97934400 AAGAGAAAAAAGAAAAGGAGAGG + Intronic
1057939607 9:99270085-99270107 CAAAGTTAAAAGATAAGTGATGG + Intergenic
1058789455 9:108427618-108427640 GATAGTAAAAAGATCAGTGGTGG - Intergenic
1059529889 9:115026169-115026191 CAGAGTAAATTGAGAAGTGCTGG + Intronic
1059672843 9:116507797-116507819 TAAAGTAGAAAGAGAAGTGGTGG - Intronic
1060613584 9:124990711-124990733 AAAAGAAAAAAGAAAAATGGTGG + Intronic
1061726346 9:132584021-132584043 AGAGGTAAAAAGAAAAGTGGAGG - Intronic
1062427795 9:136513966-136513988 CAAAATAAAGAAAAAAGTGGGGG + Intronic
1203427414 Un_GL000195v1:54279-54301 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1203438793 Un_GL000195v1:168676-168698 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1186147766 X:6642761-6642783 CACAGAAAAATGACAAGTGGGGG - Intergenic
1186179418 X:6958527-6958549 CATTGTAAAAAGTAAAGTAGAGG - Intergenic
1186368380 X:8919805-8919827 AAGATAAAAAAAAAAAGTGGAGG - Intergenic
1186644801 X:11495257-11495279 CAGAGAGAAAAGGAAAGGGGTGG - Intronic
1186687742 X:11943234-11943256 AAGAGTAAAAAGAAAAAGGCAGG - Intergenic
1186871722 X:13780604-13780626 TAGAGACAAAAGAAAAGTAGAGG - Intronic
1186957583 X:14700268-14700290 CAGAGTGAGAAGAGAAGTGGAGG + Intronic
1187218577 X:17301023-17301045 CCTAGGAAAAAGAATAGTGGAGG + Intergenic
1187267125 X:17745391-17745413 CAGAACTAAAAGAAAAGTTGAGG - Intronic
1187857715 X:23653087-23653109 CAGAGTAACAAGACAAGAGCAGG - Intergenic
1188543480 X:31275825-31275847 TAGAGGAAAAGGAAAAGTGTAGG + Intronic
1188592396 X:31853707-31853729 CAGATTAAAAAAAAAAATGATGG + Intronic
1188779950 X:34269590-34269612 CAGAGTAAAGAGAAAGGTAAAGG + Intergenic
1188984293 X:36755596-36755618 CAGACTAAGGAGAAAAGTTGTGG - Intergenic
1189097999 X:38160245-38160267 CAGAGTAAGCAGAAAAGGTGAGG + Intronic
1189393800 X:40602348-40602370 CAGAGTAAATAAAGAAGAGGAGG + Intronic
1189665444 X:43350211-43350233 CACTGTAAAAAGTAAAGTAGAGG + Intergenic
1191922208 X:66269110-66269132 CTGAGGAAAAAGAAAACTGGGGG + Intergenic
1191998744 X:67125549-67125571 TAGAATAGAGAGAAAAGTGGAGG + Intergenic
1192194073 X:69016972-69016994 CAGAGGAAAGAGTAAGGTGGAGG - Intergenic
1192836656 X:74806982-74807004 AAGAGGAAAAACAAAATTGGAGG - Intronic
1193020568 X:76787963-76787985 CAGAGTAAACAGAAAACCAGCGG + Intergenic
1193535499 X:82710247-82710269 CAGAGGATATAGGAAAGTGGAGG + Intergenic
1193562539 X:83037132-83037154 CTGAGCAAAAAGAAAAGAGCTGG + Intergenic
1193674532 X:84433627-84433649 CTGAGTAAAAAGAACAATGCAGG - Intronic
1193676932 X:84465963-84465985 CTAACTAAAAAGAAAAGTTGAGG + Intronic
1194031815 X:88826181-88826203 CAGAGAAAAGTGAAAAGTGGGGG - Intergenic
1194121022 X:89964372-89964394 CAGAGTAAAAAGACAACTTACGG - Intergenic
1194306252 X:92253380-92253402 CAAAGCTAAAAGAAAAGTGGAGG - Intronic
1194332795 X:92604573-92604595 GAAAATAAAAAGAAAAATGGCGG + Intronic
1194993302 X:100568278-100568300 CGAAGTAAATAGAAAAGAGGAGG - Intergenic
1195173932 X:102296920-102296942 GAGAGTAAAGAGATAAGTTGAGG + Intergenic
1195184933 X:102390173-102390195 GAGAGTAAAGAGATAAGTTGAGG - Intronic
1195318434 X:103700987-103701009 CAAAGAAAAAAGAAACTTGGTGG + Intergenic
1195609194 X:106845752-106845774 AAGTGTTAAAAGAAAAGTGGGGG - Intronic
1195611217 X:106869297-106869319 CACAGTAAAAAGAACATTGGGGG - Intronic
1195744766 X:108105668-108105690 CTGAGAACAAAGGAAAGTGGTGG - Intronic
1195824850 X:108988587-108988609 CCTAGACAAAAGAAAAGTGGAGG - Intergenic
1195897010 X:109756018-109756040 AAGAGAAAAAAAAAGAGTGGAGG + Intergenic
1196040005 X:111192348-111192370 AAAAATAAAAAAAAAAGTGGGGG + Intronic
1196514923 X:116598530-116598552 CTAAGCAAAAAGAAAACTGGAGG - Intergenic
1197261021 X:124318184-124318206 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1197611197 X:128640432-128640454 CAAAAAAAAAAAAAAAGTGGTGG + Intergenic
1198431645 X:136573045-136573067 CAAGATAAAAATAAAAGTGGAGG + Intergenic
1198446846 X:136725842-136725864 CACAGGAAAAAAAAAGGTGGAGG + Intronic
1198559976 X:137838990-137839012 CAGACTAGAAAGGATAGTGGGGG + Intergenic
1198725946 X:139677069-139677091 CACACTAAGAGGAAAAGTGGTGG + Intronic
1198980052 X:142385256-142385278 GAGAGTGAAAAGGAAAATGGAGG + Intergenic
1199278311 X:145971489-145971511 CCAAGAAGAAAGAAAAGTGGGGG - Intergenic
1199530584 X:148843243-148843265 CAGATTAAAAAAAAAAAAGGGGG - Intronic
1200473882 Y:3621872-3621894 CAGAGTAAAAAGACAACTTACGG - Intergenic
1201949501 Y:19548525-19548547 AAAAGAAAAAAGAAAAGGGGAGG - Intergenic