ID: 1164557541

View in Genome Browser
Species Human (GRCh38)
Location 19:29265410-29265432
Sequence TGTAATGTGGTCTTTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164557541_1164557546 13 Left 1164557541 19:29265410-29265432 CCTCTGGGAAAGACCACATTACA No data
Right 1164557546 19:29265446-29265468 GTTCCTGAATGTGTCCATACTGG No data
1164557541_1164557549 21 Left 1164557541 19:29265410-29265432 CCTCTGGGAAAGACCACATTACA No data
Right 1164557549 19:29265454-29265476 ATGTGTCCATACTGGAATGTGGG No data
1164557541_1164557551 28 Left 1164557541 19:29265410-29265432 CCTCTGGGAAAGACCACATTACA No data
Right 1164557551 19:29265461-29265483 CATACTGGAATGTGGGTCTCTGG No data
1164557541_1164557548 20 Left 1164557541 19:29265410-29265432 CCTCTGGGAAAGACCACATTACA No data
Right 1164557548 19:29265453-29265475 AATGTGTCCATACTGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164557541 Original CRISPR TGTAATGTGGTCTTTCCCAG AGG (reversed) Intergenic
No off target data available for this crispr