ID: 1164563126

View in Genome Browser
Species Human (GRCh38)
Location 19:29307852-29307874
Sequence TGAGCTCTGCTTCAGCCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164563126_1164563128 11 Left 1164563126 19:29307852-29307874 CCATTTGGCTGAAGCAGAGCTCA No data
Right 1164563128 19:29307886-29307908 ACAACTTGCCAGACCTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164563126 Original CRISPR TGAGCTCTGCTTCAGCCAAA TGG (reversed) Intergenic
No off target data available for this crispr