ID: 1164565745

View in Genome Browser
Species Human (GRCh38)
Location 19:29324618-29324640
Sequence CCACTCTCCCCACAGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164565741_1164565745 -7 Left 1164565741 19:29324602-29324624 CCTGGAGGGGCATATCCCACTCT No data
Right 1164565745 19:29324618-29324640 CCACTCTCCCCACAGCCAGGTGG No data
1164565740_1164565745 -6 Left 1164565740 19:29324601-29324623 CCCTGGAGGGGCATATCCCACTC No data
Right 1164565745 19:29324618-29324640 CCACTCTCCCCACAGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164565745 Original CRISPR CCACTCTCCCCACAGCCAGG TGG Intergenic
No off target data available for this crispr