ID: 1164567658

View in Genome Browser
Species Human (GRCh38)
Location 19:29339469-29339491
Sequence CCTCTTCCTTCTCTTGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164567658_1164567673 20 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567673 19:29339512-29339534 GAGGAGGAGGAGGAGGAGGAAGG 0: 225
1: 898
2: 2321
3: 5228
4: 11645
1164567658_1164567674 26 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567674 19:29339518-29339540 GAGGAGGAGGAGGAAGGAGAAGG 0: 11
1: 181
2: 927
3: 3383
4: 10568
1164567658_1164567666 -2 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567666 19:29339490-29339512 GGAGGAAGAAGGGGAAGTGGAGG No data
1164567658_1164567669 7 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567669 19:29339499-29339521 AGGGGAAGTGGAGGAGGAGGAGG No data
1164567658_1164567665 -5 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567665 19:29339487-29339509 AGAGGAGGAAGAAGGGGAAGTGG No data
1164567658_1164567670 10 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567670 19:29339502-29339524 GGAAGTGGAGGAGGAGGAGGAGG No data
1164567658_1164567675 27 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567675 19:29339519-29339541 AGGAGGAGGAGGAAGGAGAAGGG 0: 4
1: 43
2: 567
3: 19673
4: 84037
1164567658_1164567671 13 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567671 19:29339505-29339527 AGTGGAGGAGGAGGAGGAGGAGG No data
1164567658_1164567667 1 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567667 19:29339493-29339515 GGAAGAAGGGGAAGTGGAGGAGG No data
1164567658_1164567668 4 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567668 19:29339496-29339518 AGAAGGGGAAGTGGAGGAGGAGG No data
1164567658_1164567672 16 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567672 19:29339508-29339530 GGAGGAGGAGGAGGAGGAGGAGG 0: 1901
1: 5100
2: 10705
3: 16594
4: 27534
1164567658_1164567676 28 Left 1164567658 19:29339469-29339491 CCTCAACCAAGAGAAGGAAGAGG No data
Right 1164567676 19:29339520-29339542 GGAGGAGGAGGAAGGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164567658 Original CRISPR CCTCTTCCTTCTCTTGGTTG AGG (reversed) Intergenic
No off target data available for this crispr