ID: 1164569856

View in Genome Browser
Species Human (GRCh38)
Location 19:29366027-29366049
Sequence CTGTGTCAGCAGAGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164569856_1164569869 22 Left 1164569856 19:29366027-29366049 CCCCCTGCCCTCTGCTGACACAG No data
Right 1164569869 19:29366072-29366094 CAGCCCAGGGTAGAAATATTGGG No data
1164569856_1164569868 21 Left 1164569856 19:29366027-29366049 CCCCCTGCCCTCTGCTGACACAG No data
Right 1164569868 19:29366071-29366093 ACAGCCCAGGGTAGAAATATTGG No data
1164569856_1164569865 9 Left 1164569856 19:29366027-29366049 CCCCCTGCCCTCTGCTGACACAG No data
Right 1164569865 19:29366059-29366081 GCAACCAGCCAGACAGCCCAGGG No data
1164569856_1164569864 8 Left 1164569856 19:29366027-29366049 CCCCCTGCCCTCTGCTGACACAG No data
Right 1164569864 19:29366058-29366080 TGCAACCAGCCAGACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164569856 Original CRISPR CTGTGTCAGCAGAGGGCAGG GGG (reversed) Intergenic
No off target data available for this crispr