ID: 1164571787

View in Genome Browser
Species Human (GRCh38)
Location 19:29379993-29380015
Sequence GGTCCGCATGGAATTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164571778_1164571787 5 Left 1164571778 19:29379965-29379987 CCCTGTGCACAGACTCACCCCTC No data
Right 1164571787 19:29379993-29380015 GGTCCGCATGGAATTGAGACAGG No data
1164571779_1164571787 4 Left 1164571779 19:29379966-29379988 CCTGTGCACAGACTCACCCCTCA No data
Right 1164571787 19:29379993-29380015 GGTCCGCATGGAATTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164571787 Original CRISPR GGTCCGCATGGAATTGAGAC AGG Intergenic
No off target data available for this crispr