ID: 1164572665

View in Genome Browser
Species Human (GRCh38)
Location 19:29385445-29385467
Sequence CTGGGAGGGGGAAATGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164572653_1164572665 -3 Left 1164572653 19:29385425-29385447 CCCAGCAAGGACTCCAATCCCTG No data
Right 1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG No data
1164572651_1164572665 13 Left 1164572651 19:29385409-29385431 CCTTCACGGCACATCACCCAGCA No data
Right 1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG No data
1164572654_1164572665 -4 Left 1164572654 19:29385426-29385448 CCAGCAAGGACTCCAATCCCTGG No data
Right 1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG No data
1164572646_1164572665 28 Left 1164572646 19:29385394-29385416 CCGCCAGGCGCAGCCCCTTCACG No data
Right 1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG No data
1164572649_1164572665 15 Left 1164572649 19:29385407-29385429 CCCCTTCACGGCACATCACCCAG No data
Right 1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG No data
1164572650_1164572665 14 Left 1164572650 19:29385408-29385430 CCCTTCACGGCACATCACCCAGC No data
Right 1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG No data
1164572648_1164572665 25 Left 1164572648 19:29385397-29385419 CCAGGCGCAGCCCCTTCACGGCA No data
Right 1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164572665 Original CRISPR CTGGGAGGGGGAAATGGACC AGG Intergenic
No off target data available for this crispr