ID: 1164573070

View in Genome Browser
Species Human (GRCh38)
Location 19:29387917-29387939
Sequence GTGTCCACACATGCCGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164573068_1164573070 -8 Left 1164573068 19:29387902-29387924 CCTCAACTTTGTATAGTGTCCAC No data
Right 1164573070 19:29387917-29387939 GTGTCCACACATGCCGCCGAGGG No data
1164573065_1164573070 16 Left 1164573065 19:29387878-29387900 CCAGATGCATGGCCCGGCTGGAG No data
Right 1164573070 19:29387917-29387939 GTGTCCACACATGCCGCCGAGGG No data
1164573067_1164573070 3 Left 1164573067 19:29387891-29387913 CCGGCTGGAGTCCTCAACTTTGT No data
Right 1164573070 19:29387917-29387939 GTGTCCACACATGCCGCCGAGGG No data
1164573066_1164573070 4 Left 1164573066 19:29387890-29387912 CCCGGCTGGAGTCCTCAACTTTG No data
Right 1164573070 19:29387917-29387939 GTGTCCACACATGCCGCCGAGGG No data
1164573063_1164573070 21 Left 1164573063 19:29387873-29387895 CCTTTCCAGATGCATGGCCCGGC No data
Right 1164573070 19:29387917-29387939 GTGTCCACACATGCCGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164573070 Original CRISPR GTGTCCACACATGCCGCCGA GGG Intergenic
No off target data available for this crispr