ID: 1164574655

View in Genome Browser
Species Human (GRCh38)
Location 19:29398636-29398658
Sequence CTGTCCCAGCACCTGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164574641_1164574655 21 Left 1164574641 19:29398592-29398614 CCCAAGCCCTGTGCACCTCCCAC No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574651_1164574655 -2 Left 1164574651 19:29398615-29398637 CCACACTCACCTGGGTGCCACCT No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574639_1164574655 28 Left 1164574639 19:29398585-29398607 CCTTTTCCCCAAGCCCTGTGCAC No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574638_1164574655 29 Left 1164574638 19:29398584-29398606 CCCTTTTCCCCAAGCCCTGTGCA No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574646_1164574655 6 Left 1164574646 19:29398607-29398629 CCTCCCACCCACACTCACCTGGG No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574642_1164574655 20 Left 1164574642 19:29398593-29398615 CCAAGCCCTGTGCACCTCCCACC No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574640_1164574655 22 Left 1164574640 19:29398591-29398613 CCCCAAGCCCTGTGCACCTCCCA No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574644_1164574655 14 Left 1164574644 19:29398599-29398621 CCTGTGCACCTCCCACCCACACT No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574637_1164574655 30 Left 1164574637 19:29398583-29398605 CCCCTTTTCCCCAAGCCCTGTGC No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574650_1164574655 -1 Left 1164574650 19:29398614-29398636 CCCACACTCACCTGGGTGCCACC No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574643_1164574655 15 Left 1164574643 19:29398598-29398620 CCCTGTGCACCTCCCACCCACAC No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574649_1164574655 2 Left 1164574649 19:29398611-29398633 CCACCCACACTCACCTGGGTGCC No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data
1164574648_1164574655 3 Left 1164574648 19:29398610-29398632 CCCACCCACACTCACCTGGGTGC No data
Right 1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164574655 Original CRISPR CTGTCCCAGCACCTGAGCTC TGG Intergenic
No off target data available for this crispr