ID: 1164575016

View in Genome Browser
Species Human (GRCh38)
Location 19:29400845-29400867
Sequence AGAAAGGGCCACAGTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164575001_1164575016 22 Left 1164575001 19:29400800-29400822 CCCACACAGACCAAGCCCACTCT No data
Right 1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG No data
1164575009_1164575016 -5 Left 1164575009 19:29400827-29400849 CCAAAAGAGGCCCTTGGGAGAAA No data
Right 1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG No data
1164575003_1164575016 12 Left 1164575003 19:29400810-29400832 CCAAGCCCACTCTTGTTCCAAAA No data
Right 1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG No data
1164575006_1164575016 6 Left 1164575006 19:29400816-29400838 CCACTCTTGTTCCAAAAGAGGCC No data
Right 1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG No data
1164575000_1164575016 23 Left 1164575000 19:29400799-29400821 CCCCACACAGACCAAGCCCACTC No data
Right 1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG No data
1164575002_1164575016 21 Left 1164575002 19:29400801-29400823 CCACACAGACCAAGCCCACTCTT No data
Right 1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG No data
1164575005_1164575016 7 Left 1164575005 19:29400815-29400837 CCCACTCTTGTTCCAAAAGAGGC No data
Right 1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164575016 Original CRISPR AGAAAGGGCCACAGTGGGCA TGG Intergenic
No off target data available for this crispr