ID: 1164576261

View in Genome Browser
Species Human (GRCh38)
Location 19:29407131-29407153
Sequence GCAAGCATTTCTGGAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164576261_1164576263 -2 Left 1164576261 19:29407131-29407153 CCTTCTCTTCCAGAAATGCTTGC No data
Right 1164576263 19:29407152-29407174 GCCCCTTCCTCCTTGTTACCTGG No data
1164576261_1164576270 16 Left 1164576261 19:29407131-29407153 CCTTCTCTTCCAGAAATGCTTGC No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164576261 Original CRISPR GCAAGCATTTCTGGAAGAGA AGG (reversed) Intergenic
No off target data available for this crispr