ID: 1164576262

View in Genome Browser
Species Human (GRCh38)
Location 19:29407140-29407162
Sequence GAGGAAGGGGCAAGCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164576262_1164576270 7 Left 1164576262 19:29407140-29407162 CCAGAAATGCTTGCCCCTTCCTC No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data
1164576262_1164576277 28 Left 1164576262 19:29407140-29407162 CCAGAAATGCTTGCCCCTTCCTC No data
Right 1164576277 19:29407191-29407213 GGCCTCCCCTAATCCTCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164576262 Original CRISPR GAGGAAGGGGCAAGCATTTC TGG (reversed) Intergenic
No off target data available for this crispr