ID: 1164576265

View in Genome Browser
Species Human (GRCh38)
Location 19:29407154-29407176
Sequence AGCCAGGTAACAAGGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164576265_1164576270 -7 Left 1164576265 19:29407154-29407176 CCCTTCCTCCTTGTTACCTGGCT No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data
1164576265_1164576277 14 Left 1164576265 19:29407154-29407176 CCCTTCCTCCTTGTTACCTGGCT No data
Right 1164576277 19:29407191-29407213 GGCCTCCCCTAATCCTCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164576265 Original CRISPR AGCCAGGTAACAAGGAGGAA GGG (reversed) Intergenic
No off target data available for this crispr