ID: 1164576266

View in Genome Browser
Species Human (GRCh38)
Location 19:29407155-29407177
Sequence GAGCCAGGTAACAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164576266_1164576277 13 Left 1164576266 19:29407155-29407177 CCTTCCTCCTTGTTACCTGGCTC No data
Right 1164576277 19:29407191-29407213 GGCCTCCCCTAATCCTCAACTGG No data
1164576266_1164576270 -8 Left 1164576266 19:29407155-29407177 CCTTCCTCCTTGTTACCTGGCTC No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164576266 Original CRISPR GAGCCAGGTAACAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr