ID: 1164576270

View in Genome Browser
Species Human (GRCh38)
Location 19:29407170-29407192
Sequence CCTGGCTCCCCCGATCCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164576260_1164576270 30 Left 1164576260 19:29407117-29407139 CCTCACACTCTCTGCCTTCTCTT No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data
1164576264_1164576270 -6 Left 1164576264 19:29407153-29407175 CCCCTTCCTCCTTGTTACCTGGC No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data
1164576262_1164576270 7 Left 1164576262 19:29407140-29407162 CCAGAAATGCTTGCCCCTTCCTC No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data
1164576265_1164576270 -7 Left 1164576265 19:29407154-29407176 CCCTTCCTCCTTGTTACCTGGCT No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data
1164576261_1164576270 16 Left 1164576261 19:29407131-29407153 CCTTCTCTTCCAGAAATGCTTGC No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data
1164576266_1164576270 -8 Left 1164576266 19:29407155-29407177 CCTTCCTCCTTGTTACCTGGCTC No data
Right 1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164576270 Original CRISPR CCTGGCTCCCCCGATCCCTT AGG Intergenic
No off target data available for this crispr