ID: 1164578731

View in Genome Browser
Species Human (GRCh38)
Location 19:29421264-29421286
Sequence GTGCAGACACGGCCTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164578721_1164578731 16 Left 1164578721 19:29421225-29421247 CCAGTTTTAAACCTCTGATAATG No data
Right 1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG No data
1164578724_1164578731 5 Left 1164578724 19:29421236-29421258 CCTCTGATAATGGAGGTTTATGG No data
Right 1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG No data
1164578720_1164578731 17 Left 1164578720 19:29421224-29421246 CCCAGTTTTAAACCTCTGATAAT No data
Right 1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164578731 Original CRISPR GTGCAGACACGGCCTGGGCA GGG Intergenic
No off target data available for this crispr