ID: 1164585991

View in Genome Browser
Species Human (GRCh38)
Location 19:29476360-29476382
Sequence ACAAGGACCCCTGTGGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164585991_1164585995 4 Left 1164585991 19:29476360-29476382 CCTCAGCCCACAGGGGTCCTTGT No data
Right 1164585995 19:29476387-29476409 TAGAGAAGCTGCCACATTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164585991 Original CRISPR ACAAGGACCCCTGTGGGCTG AGG (reversed) Intergenic
No off target data available for this crispr