ID: 1164594376

View in Genome Browser
Species Human (GRCh38)
Location 19:29524390-29524412
Sequence CCTCAGCTTCTGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164594376_1164594387 11 Left 1164594376 19:29524390-29524412 CCCTCTCCCTTCAGAAGCTGAGG No data
Right 1164594387 19:29524424-29524446 GCCTGGCAGGGTCTTACATTCGG No data
1164594376_1164594384 -6 Left 1164594376 19:29524390-29524412 CCCTCTCCCTTCAGAAGCTGAGG No data
Right 1164594384 19:29524407-29524429 CTGAGGACAGCAATGGGGCCTGG No data
1164594376_1164594386 -1 Left 1164594376 19:29524390-29524412 CCCTCTCCCTTCAGAAGCTGAGG No data
Right 1164594386 19:29524412-29524434 GACAGCAATGGGGCCTGGCAGGG No data
1164594376_1164594390 13 Left 1164594376 19:29524390-29524412 CCCTCTCCCTTCAGAAGCTGAGG No data
Right 1164594390 19:29524426-29524448 CTGGCAGGGTCTTACATTCGGGG No data
1164594376_1164594392 24 Left 1164594376 19:29524390-29524412 CCCTCTCCCTTCAGAAGCTGAGG No data
Right 1164594392 19:29524437-29524459 TTACATTCGGGGGTCCAAAGTGG No data
1164594376_1164594385 -2 Left 1164594376 19:29524390-29524412 CCCTCTCCCTTCAGAAGCTGAGG No data
Right 1164594385 19:29524411-29524433 GGACAGCAATGGGGCCTGGCAGG No data
1164594376_1164594391 14 Left 1164594376 19:29524390-29524412 CCCTCTCCCTTCAGAAGCTGAGG No data
Right 1164594391 19:29524427-29524449 TGGCAGGGTCTTACATTCGGGGG No data
1164594376_1164594389 12 Left 1164594376 19:29524390-29524412 CCCTCTCCCTTCAGAAGCTGAGG No data
Right 1164594389 19:29524425-29524447 CCTGGCAGGGTCTTACATTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164594376 Original CRISPR CCTCAGCTTCTGAAGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr