ID: 1164594743

View in Genome Browser
Species Human (GRCh38)
Location 19:29525785-29525807
Sequence GCCCCGCCCCGCACCCGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164594743_1164594745 -1 Left 1164594743 19:29525785-29525807 CCCAAGCGGGTGCGGGGCGGGGC No data
Right 1164594745 19:29525807-29525829 CTGTACTCCAACCAGAAAGACGG No data
1164594743_1164594746 2 Left 1164594743 19:29525785-29525807 CCCAAGCGGGTGCGGGGCGGGGC No data
Right 1164594746 19:29525810-29525832 TACTCCAACCAGAAAGACGGTGG No data
1164594743_1164594749 24 Left 1164594743 19:29525785-29525807 CCCAAGCGGGTGCGGGGCGGGGC No data
Right 1164594749 19:29525832-29525854 GTCCCTCCGAGCGACCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164594743 Original CRISPR GCCCCGCCCCGCACCCGCTT GGG (reversed) Intergenic