ID: 1164594846

View in Genome Browser
Species Human (GRCh38)
Location 19:29526107-29526129
Sequence CGCCCCCGCCGGTTCCTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164594846_1164594851 -6 Left 1164594846 19:29526107-29526129 CCGCGGAGGAACCGGCGGGGGCG No data
Right 1164594851 19:29526124-29526146 GGGGCGGCTGCGGGAGCCGAAGG No data
1164594846_1164594858 30 Left 1164594846 19:29526107-29526129 CCGCGGAGGAACCGGCGGGGGCG No data
Right 1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG No data
1164594846_1164594852 -3 Left 1164594846 19:29526107-29526129 CCGCGGAGGAACCGGCGGGGGCG No data
Right 1164594852 19:29526127-29526149 GCGGCTGCGGGAGCCGAAGGAGG No data
1164594846_1164594857 23 Left 1164594846 19:29526107-29526129 CCGCGGAGGAACCGGCGGGGGCG No data
Right 1164594857 19:29526153-29526175 CAATCGGGAGCAGAACCAGAAGG No data
1164594846_1164594855 8 Left 1164594846 19:29526107-29526129 CCGCGGAGGAACCGGCGGGGGCG No data
Right 1164594855 19:29526138-29526160 AGCCGAAGGAGGTGGCAATCGGG No data
1164594846_1164594853 0 Left 1164594846 19:29526107-29526129 CCGCGGAGGAACCGGCGGGGGCG No data
Right 1164594853 19:29526130-29526152 GCTGCGGGAGCCGAAGGAGGTGG No data
1164594846_1164594854 7 Left 1164594846 19:29526107-29526129 CCGCGGAGGAACCGGCGGGGGCG No data
Right 1164594854 19:29526137-29526159 GAGCCGAAGGAGGTGGCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164594846 Original CRISPR CGCCCCCGCCGGTTCCTCCG CGG (reversed) Intergenic
No off target data available for this crispr